Morpholino

MO9-tp53

ID
ZDB-MRPHLNO-100429-7
Name
MO9-tp53
Previous Names
None
Target
Sequence
5' - CCCTTGCGAACTTACATCAAATTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO9-tp53
Expressed Gene Anatomy Figures
tp53 Fig. 6 from Parant et al., 2010
Phenotype
Phenotype resulting from MO9-tp53
No data available
Phenotype of all Fish created by or utilizing MO9-tp53
Phenotype Fish Conditions Figures
liver fabp10a expression absent, abnormal WT + MO1-atp7b + MO9-tp53 standard conditions Fig. 3 from Reed et al., 2018
liver decreased size, abnormal WT + MO1-atp7b + MO9-tp53 standard conditions Fig. 3 from Reed et al., 2018
vertical myoseptum U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction U-shaped, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle cell increased length, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal WT + MO1-itga6a + MO2-itga6a + MO9-tp53 standard conditions Fig. 5 with image from Goody et al., 2012
myotome U-shaped, abnormal WT + MO1-mibp2 + MO2-mibp2 + MO9-tp53 standard conditions Fig. 1 with image from Goody et al., 2010
whole organism decreased length, abnormal WT + MO1-mibp2 + MO2-mibp2 + MO9-tp53 standard conditions Fig. 1 with image from Goody et al., 2010
hindbrain DsRed expression increased amount, abnormal os4Tg + MO1-atp7b + MO9-tp53 standard conditions Fig. 3 from Reed et al., 2018
head necrotic, abnormal esco2hi2865Tg/hi2865Tg + MO9-tp53 standard conditions Fig. 1 with image from Percival et al., 2015
apoptotic process increased process quality, abnormal esco2hi2865Tg/hi2865Tg + MO9-tp53 standard conditions Fig. 2 with image from Percival et al., 2015
growth decreased process quality, abnormal esco2hi2865Tg/hi2865Tg + MO9-tp53 standard conditions Fig. 1 with image from Percival et al., 2015
head decreased size, abnormal esco2hi2865Tg/hi2865Tg + MO9-tp53 standard conditions Fig. 1 with image from Percival et al., 2015
Citations