Morpholino
MO1-mgaa
- ID
- ZDB-MRPHLNO-100426-1
- Name
- MO1-mgaa
- Previous Names
-
- MO1-mga
- Target
- Sequence
-
5' - CATGGGAATTAAGTCATCTGGATAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5' UTR of the mature mga transcript.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mgaa
Expressed Gene | Anatomy | Figures |
---|---|---|
fabp2 |
Fig. 6 ![]() ![]() |
|
foxa2 |
text only
from Rikin et al., 2010 |
|
gata4 |
Fig. 7 ![]() |
|
gata5 |
Fig. 7 ![]() |
|
gata6 |
Fig. 7 ![]() |
|
gsc |
text only
from Rikin et al., 2010 |
|
lft2 |
text only
from Rikin et al., 2010 |
|
lhx1a |
text only
from Rikin et al., 2010 |
|
mixl1 |
text only
from Rikin et al., 2010 |
|
nkx2.5 |
Fig. 7 ![]() |
|
noto |
text only
from Rikin et al., 2010 |
|
pitx2 |
text only
from Rikin et al., 2010 |
|
sox17 |
text only
from Rikin et al., 2010 |
|
sox32 |
text only
from Rikin et al., 2010 |
|
tbx5a |
Fig. 7 ![]() |
|
tbx16 |
text only
from Rikin et al., 2010 |
|
tbx16l |
text only
from Rikin et al., 2010 |
|
tbx20 |
Fig. 7 ![]() |
|
tbxta |
text only
from Rikin et al., 2010 |
|
tfa |
|
Fig. 6 ![]() ![]() |
xbp1 |
text only
from Rikin et al., 2010 |
Phenotype
Phenotype resulting from MO1-mgaa
Phenotype of all Fish created by or utilizing MO1-mgaa
Citations