Morpholino

MO1-mgaa

ID
ZDB-MRPHLNO-100426-1
Name
MO1-mgaa
Previous Names
  • MO1-mga
Target
Sequence
5' - CATGGGAATTAAGTCATCTGGATAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5' UTR of the mature mga transcript.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mgaa
No data available
Phenotype
Phenotype resulting from MO1-mgaa
Phenotype Fish Figures
ball size, abnormal WT + MO1-mgaa text only from Rikin et al., 2010
blood nucleate erythrocyte decreased amount, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
brain apoptotic, abnormal WT + MO1-mgaa Fig. 3 with imageFig. 9 with imageFig. 11 with image from Rikin et al., 2010
digestive tract morphogenesis disrupted, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
extension degenerate, abnormal twu34Tg + MO1-mgaa Fig. 3 with imageFig. 8 with image from Rikin et al., 2010
eye decreased size, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
forebrain midbrain boundary amorphous, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
heart looping disrupted, abnormal twu34Tg + MO1-mgaa Fig. 3 with imageFig. 4 with imageFig. 8 with image from Rikin et al., 2010
heart tube collapsed, abnormal twu34Tg + MO1-mgaa Fig. 4 with image from Rikin et al., 2010
heart tube decreased thickness, abnormal twu34Tg + MO1-mgaa Fig. 4 with image from Rikin et al., 2010
hindbrain aplastic, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
hindbrain apoptotic, abnormal WT + MO1-mgaa Fig. 10 with image from Rikin et al., 2010
hindbrain edematous, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
integument colorless, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
liver aplastic, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
liver hypoplastic, abnormal WT + MO1-mgaa Fig. 11 with image from Rikin et al., 2010
liver development disrupted, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
midbrain apoptotic, abnormal WT + MO1-mgaa Fig. 10 with image from Rikin et al., 2010
midbrain hindbrain boundary amorphous, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
pancreas aplastic, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
pancreas development disrupted, abnormal s854Tg + MO1-mgaa Fig. 5 with image from Rikin et al., 2010
pericardium edematous, abnormal twu34Tg + MO1-mgaa Fig. 3 with imageFig. 4 with imageFig. 8 with image from Rikin et al., 2010
whole organism dead, abnormal WT + MO1-mgaa text only from Rikin et al., 2010
whole organism decreased size, abnormal WT + MO1-mgaa Fig. 3 with image from Rikin et al., 2010
Phenotype of all Fish created by or utilizing MO1-mgaa
Phenotype Fish Conditions Figures
hindbrain edematous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
blood nucleate erythrocyte decreased amount, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
whole organism dead, abnormal WT + MO1-mgaa standard conditions text only from Rikin et al., 2010
whole organism decreased size, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
ball size, abnormal WT + MO1-mgaa standard conditions text only from Rikin et al., 2010
forebrain midbrain boundary amorphous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
liver hypoplastic, abnormal WT + MO1-mgaa standard conditions Fig. 11 with image from Rikin et al., 2010
eye decreased size, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
heart looping disrupted, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
pericardium edematous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
integument colorless, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
extension degenerate, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
brain apoptotic, abnormal WT + MO1-mgaa standard conditions Fig. 3 with imageFig. 9 with imageFig. 11 with image from Rikin et al., 2010
midbrain apoptotic, abnormal WT + MO1-mgaa standard conditions Fig. 10 with image from Rikin et al., 2010
midbrain hindbrain boundary amorphous, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
hindbrain aplastic, abnormal WT + MO1-mgaa standard conditions Fig. 3 with image from Rikin et al., 2010
hindbrain apoptotic, abnormal WT + MO1-mgaa standard conditions Fig. 10 with image from Rikin et al., 2010
pancreas aplastic, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
digestive tract morphogenesis disrupted, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
pancreas development disrupted, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
liver development disrupted, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
liver aplastic, abnormal s854Tg + MO1-mgaa standard conditions Fig. 5 with image from Rikin et al., 2010
pericardium edematous, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with imageFig. 8 with image from Rikin et al., 2010
extension degenerate, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 8 with image from Rikin et al., 2010
heart tube decreased thickness, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with image from Rikin et al., 2010
heart looping disrupted, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with imageFig. 8 with image from Rikin et al., 2010
heart tube collapsed, abnormal twu34Tg + MO1-mgaa standard conditions Fig. 4 with image from Rikin et al., 2010
liver hypoplastic, abnormal WT + MO1-gata4 + MO1-mgaa standard conditions Fig. 11 with image from Rikin et al., 2010
extension degenerate, abnormal twu34Tg + MO1-gata4 + MO1-mgaa standard conditions Fig. 8 with image from Rikin et al., 2010
Citations