Morpholino

MO1-nes

ID
ZDB-MRPHLNO-100423-15
Name
MO1-nes
Previous Names
None
Target
Sequence
5' - CGAGAGATATGAAGTGAAATCTCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nes
Expressed Gene Anatomy Figures
ascl1b Fig. 5 with image,  Fig. 8 with image from Chen et al., 2010
isl1a Fig. 6 with image from Chen et al., 2010
mcm5 Fig. 9 with image from Chen et al., 2010
otx2b Fig. 5 with image from Chen et al., 2010
pcna Fig. 9 with image from Chen et al., 2010
Phenotype
Phenotype resulting from MO1-nes
Phenotype Fish Figures
brain apoptotic, abnormal AB + MO1-nes Fig. 7 with image from Chen et al., 2010
brain decreased size, abnormal AB + MO1-nes Fig. 2 with image,  text only from Chen et al., 2010
brain hydrocephalic, abnormal AB + MO1-nes Fig. 2 with image,  text only from Chen et al., 2010
brain development disrupted, abnormal AB + MO1-nes Fig. 2 with image from Chen et al., 2010
cranial nerve III decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve IV decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve V decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve V disorganized, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve VII decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve VII disorganized, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve X morphology, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve X position, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
eye apoptotic, abnormal AB + MO1-nes Fig. 7 with image from Chen et al., 2010
eye decreased size, abnormal AB + MO1-nes Fig. 2 with image,  text only from Chen et al., 2010
eye disorganized, abnormal AB + MO1-nes Fig. 2 with image,  text only from Chen et al., 2010
fourth ventricle dilated, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
glial cell decreased amount, abnormal mi2001Tg/+ + MO1-nes (AB) Fig. 6 with image from Chen et al., 2010
head decreased size, abnormal AB + MO1-nes Fig. 2 with image,  text only from Chen et al., 2010
head malformed, abnormal AB + MO1-nes Fig. 2 with image from Chen et al., 2010
hindbrain apoptotic, abnormal AB + MO1-nes Fig. 7 with image,  Fig. 8 with image from Chen et al., 2010
hindbrain decreased size, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
hindbrain disorganized, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
lens hypoplastic, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
midbrain apoptotic, abnormal AB + MO1-nes Fig. 7 with image from Chen et al., 2010
midbrain decreased size, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
midbrain disorganized, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-nes Fig. 2 with image from Chen et al., 2010
nervous system axon spatial pattern, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
optic tectum decreased size, abnormal AB + MO1-nes Fig. 2 with image,  text only from Chen et al., 2010
retina disorganized, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
tectal ventricle dilated, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
Phenotype of all Fish created by or utilizing MO1-nes
Phenotype Fish Conditions Figures
midbrain apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image from Chen et al., 2010
brain apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image from Chen et al., 2010
brain hydrocephalic, abnormal AB + MO1-nes standard conditions Fig. 2 with image,  text only from Chen et al., 2010
hindbrain disorganized, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
head malformed, abnormal AB + MO1-nes standard conditions Fig. 2 with image from Chen et al., 2010
midbrain decreased size, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
eye disorganized, abnormal AB + MO1-nes standard conditions Fig. 2 with image,  text only from Chen et al., 2010
fourth ventricle dilated, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
eye decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with image,  text only from Chen et al., 2010
eye apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image from Chen et al., 2010
hindbrain decreased size, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
retina disorganized, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
hindbrain apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image,  Fig. 8 with image from Chen et al., 2010
optic tectum decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with image,  text only from Chen et al., 2010
brain decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with image,  text only from Chen et al., 2010
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-nes standard conditions Fig. 2 with image from Chen et al., 2010
tectal ventricle dilated, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
head decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with image,  text only from Chen et al., 2010
midbrain disorganized, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
lens hypoplastic, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
brain development disrupted, abnormal AB + MO1-nes standard conditions Fig. 2 with image from Chen et al., 2010
glial cell decreased amount, abnormal mi2001Tg/+ + MO1-nes (AB) standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve V decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve III decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve X position, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve X morphology, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve VII decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve V disorganized, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve IV decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve VII disorganized, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
nervous system axon spatial pattern, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.