Morpholino
MO1-ids
- ID
- ZDB-MRPHLNO-100422-6
- Name
- MO1-ids
- Previous Names
-
- ids ATG MO (1)
- Target
- Sequence
-
5' - GTAAATACGAGCATTACATTCATTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ids
No data available
Phenotype
Phenotype resulting from MO1-ids
1 - 5 of 38 Show all
Phenotype of all Fish created by or utilizing MO1-ids
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
trabecula communis shortened, abnormal | AB + MO1-ids | control |
Fig. 5
from Lin et al., 2020 |
ethmoid cartilage shortened, abnormal | AB + MO1-ids | control |
Fig. 5
from Lin et al., 2020 |
pharyngeal arch chondrocyte decreased amount, abnormal | AB + MO1-ids | control |
Fig. 5
from Lin et al., 2020 |
palatoquadrate cartilage decreased size, abnormal | AB + MO1-ids | control |
Fig. 5
from Lin et al., 2020 |
ceratohyal cartilage decreased size, abnormal | AB + MO1-ids | control |
Fig. 5
from Lin et al., 2020 |
1 - 5 of 47 Show all
Citations
- Lin, C.Y., Lin, H.Y., Chuang, C.K., Zhang, P.H., Tu, R.Y., Lin, S.P., Tsai, H.J. (2020) Effect of Mutated ids Overexpression on IDS Enzyme Activity and Developmental Phenotypes in Zebrafish Embryos: A Valuable Index for Assessing Critical Point-Mutations Associated with Mucopolysaccharidosis Type II Occurrence in Humans. Diagnostics (Basel, Switzerland). 10(10):
- Bellesso, S., Salvalaio, M., Lualdi, S., Tognon, E., Costa, R., Braghetta, P., Giraudo, C., Stramare, R., Rigon, L., Filocamo, M., Tomanin, R., Moro, E. (2018) FGF signaling deregulation is associated with early developmental skeletal defects in animal models for mucopolysaccharidosis type II (MPSII). Human molecular genetics. 27:2262-2275
- Costa, R., Urbani, A., Salvalaio, M., Bellesso, S., Cieri, D., Zancan, I., Filocamo, M., Bonaldo, P., Szabò, I., Tomanin, R., Moro, E. (2017) Perturbations in cell signaling elicit early cardiac defects in mucopolysaccharidosis type II. Human molecular genetics. 26(9):1643-1655
- Moro, E., Tomanin, R., Friso, A., Modena, N., Tiso, N., Scarpa, M., and Argenton, F. (2010) A novel functional role of iduronate-2-sulfatase in zebrafish early development. Matrix biology : journal of the International Society for Matrix Biology. 29(1):43-50
1 - 4 of 4
Show