Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-llgl1

ID
ZDB-MRPHLNO-100419-12
Name
MO1-llgl1
Previous Names
  • MOlgl1-atg (1)
Target
Sequence
5' - CCGTCTGAACCTAAACTTCATCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-llgl1
Phenotype
Phenotype resulting from MO1-llgl1
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
cardiac muscle cell hypertrophic, abnormal WT + MO1-llgl1 Fig. 3 with image from Flinn et al., 2020
cardiac muscle cell intercalated disc morphology, abnormal WT + MO1-llgl1 Fig. S7 from Flinn et al., 2020
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO1-llgl1 Fig. S7 from Flinn et al., 2020
cardiac ventricle morphology, abnormal WT + MO1-llgl1 Fig. S5 from Flinn et al., 2020
cardiac ventricle cardiac muscle cell circular, abnormal WT + MO1-llgl1 Fig. 3 with imageFig. S6 from Flinn et al., 2020
cardiac ventricle cardiac muscle cell Ab4-yap1 labeling decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
cell population proliferation increased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 2 with image from Clark et al., 2012
epidermis cell cortex ab1-yap1 labeling decreased amount, abnormal mw43Tg + MO1-llgl1 Fig. S10 from Flinn et al., 2020
exit from mitosis decreased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 2 with image from Clark et al., 2012
eye decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
heart clu expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart lats2 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart pawr expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart ccn1 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart hbegfa expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart ccn2a expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart llgl1 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart llgl2 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart decreased object quality, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
heart GFP expression increased distribution, abnormal mw43Tg + MO1-llgl1 Fig. 5 with image from Flinn et al., 2020
heart GFP expression spatial pattern, abnormal mw43Tg + MO1-llgl1 Fig. 5 with image from Flinn et al., 2020
heart looping disrupted, abnormal WT + MO1-llgl1 Fig. S5 from Flinn et al., 2020
heart valve morphology, abnormal WT + MO1-llgl1 Fig. S6 from Flinn et al., 2020
heart valve morphogenesis process quality, abnormal WT + MO1-llgl1 Fig. 5 with imageFig. S8Fig. S9 from Flinn et al., 2020
pericardium edematous, abnormal WT + MO1-llgl1 Fig. S3 from Flinn et al., 2020
peridermal cell actin-based cell projection ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-llgl1 Fig. S2 from Magre et al., 2019
Fig. 3 with imageFig. 8 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased size, abnormal TU + MO1-llgl1 Fig. 5 with image from Raman et al., 2016
peridermal cell apical side ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 Fig. 3 with image from Raman et al., 2016
retina adherens junction distributed, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retina adherens junction increased size, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retina cell disorganized, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
retina layer formation delayed, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 1 with image from Clark et al., 2012
retinal neural layer structure, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 1 with image from Clark et al., 2012
retinal neural layer apical region increased area, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 4 with image from Clark et al., 2012
retinal neural layer cell aggregated, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 1 with image from Clark et al., 2012
Phenotype of all Fish created by or utilizing MO1-llgl1
Phenotype Fish Conditions Figures
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-llgl1 control Fig. S2 from Magre et al., 2019
Fig. 3 with imageFig. 8 with image from Raman et al., 2016
peridermal cell apical side ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 control Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased size, abnormal TU + MO1-llgl1 standard conditions Fig. 5 with image from Raman et al., 2016
peridermal cell actin-based cell projection ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 control Fig. 3 with image from Raman et al., 2016
heart ccn2a expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart llgl2 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
pericardium edematous, abnormal WT + MO1-llgl1 standard conditions Fig. S3 from Flinn et al., 2020
cardiac muscle cell hypertrophic, abnormal WT + MO1-llgl1 standard conditions Fig. 3 with image from Flinn et al., 2020
heart valve morphology, abnormal WT + MO1-llgl1 standard conditions Fig. S6 from Flinn et al., 2020
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. S7 from Flinn et al., 2020
heart llgl1 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart valve morphogenesis process quality, abnormal WT + MO1-llgl1 standard conditions Fig. 5 with imageFig. S8Fig. S9 from Flinn et al., 2020
heart ccn1 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart hbegfa expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart pawr expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
cardiac muscle cell intercalated disc morphology, abnormal WT + MO1-llgl1 standard conditions Fig. S7 from Flinn et al., 2020
heart looping disrupted, abnormal WT + MO1-llgl1 standard conditions Fig. S5 from Flinn et al., 2020
heart lats2 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart clu expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
cardiac ventricle cardiac muscle cell circular, abnormal WT + MO1-llgl1 standard conditions Fig. 3 with imageFig. S6 from Flinn et al., 2020
cardiac ventricle morphology, abnormal WT + MO1-llgl1 standard conditions Fig. S5 from Flinn et al., 2020
cardiac ventricle cardiac muscle cell Ab4-yap1 labeling decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
retinal neural layer structure, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
eye decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retinal neural layer cell aggregated, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
exit from mitosis decreased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
heart decreased object quality, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retina adherens junction distributed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with imageFig. S3 with image from Clark et al., 2012
retinal neural layer apical region increased area, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 4 with image from Clark et al., 2012
retina layer formation delayed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
cell population proliferation increased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
retina cell disorganized, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retina adherens junction increased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with imageFig. S3 with image from Clark et al., 2012
brain decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
heart GFP expression increased distribution, abnormal mw43Tg + MO1-llgl1 standard conditions Fig. 5 with image from Flinn et al., 2020
epidermis cell cortex ab1-yap1 labeling decreased amount, abnormal mw43Tg + MO1-llgl1 standard conditions Fig. S10 from Flinn et al., 2020
heart GFP expression spatial pattern, abnormal mw43Tg + MO1-llgl1 standard conditions Fig. 5 with image from Flinn et al., 2020
peridermal cell actin-based cell projection decreased length, abnormal llgl2to6/to6 + MO1-llgl1 standard conditions Fig. 3 with image from Raman et al., 2016
peridermal cell apical side ab1-llgl2 labeling decreased amount, abnormal llgl2to6/to6 + MO1-llgl1 standard conditions Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection ab1-llgl2 labeling decreased amount, abnormal llgl2to6/to6 + MO1-llgl1 standard conditions Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection length, ameliorated prkcim567/m567 + MO1-llgl1 standard conditions Fig. 5 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-llgl1 + MO1-ranbp2 standard conditions Fig. S2 from Magre et al., 2019
Citations