Morpholino

MO1-llgl1

ID
ZDB-MRPHLNO-100419-12
Name
MO1-llgl1
Previous Names
  • MOlgl1-atg (1)
Target
Sequence
5' - CCGTCTGAACCTAAACTTCATCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-llgl1
Expressed Gene Anatomy Figures
clu Fig. 6 with image from Flinn et al., 2020
ccn2a Fig. 6 with image from Flinn et al., 2020
ccn1 Fig. 6 with image from Flinn et al., 2020
hbegfa Fig. 6 with image from Flinn et al., 2020
lats2 Fig. 6 with image from Flinn et al., 2020
llgl1 Fig. 6 with image from Flinn et al., 2020
llgl2 Fig. 6 with image from Flinn et al., 2020
pawr Fig. 6 with image from Flinn et al., 2020
Phenotype
Phenotype resulting from MO1-llgl1
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
cardiac muscle cell hypertrophic, abnormal WT + MO1-llgl1 Fig. 3 with image from Flinn et al., 2020
cardiac muscle cell intercalated disc morphology, abnormal WT + MO1-llgl1 Fig. S7 from Flinn et al., 2020
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO1-llgl1 Fig. S7 from Flinn et al., 2020
cardiac ventricle morphology, abnormal WT + MO1-llgl1 Fig. S5 from Flinn et al., 2020
cardiac ventricle cardiac muscle cell circular, abnormal WT + MO1-llgl1 Fig. 3 with image,  Fig. S6 from Flinn et al., 2020
cardiac ventricle cardiac muscle cell Ab4-yap1 labeling decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
cell population proliferation increased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 2 with image from Clark et al., 2012
epidermis cell cortex ab1-yap1 labeling decreased amount, abnormal mw43Tg + MO1-llgl1 Fig. S10 from Flinn et al., 2020
exit from mitosis decreased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 2 with image from Clark et al., 2012
eye decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
heart lats2 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart clu expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart pawr expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart ccn1 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart hbegfa expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart ccn2a expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart llgl1 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart llgl2 expression decreased amount, abnormal WT + MO1-llgl1 Fig. 6 with image from Flinn et al., 2020
heart decreased object quality, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
heart GFP expression increased distribution, abnormal mw43Tg + MO1-llgl1 Fig. 5 with image from Flinn et al., 2020
heart GFP expression spatial pattern, abnormal mw43Tg + MO1-llgl1 Fig. 5 with image from Flinn et al., 2020
heart looping disrupted, abnormal WT + MO1-llgl1 Fig. S5 from Flinn et al., 2020
heart valve morphology, abnormal WT + MO1-llgl1 Fig. S6 from Flinn et al., 2020
heart valve morphogenesis process quality, abnormal WT + MO1-llgl1 Fig. 5 with image,  Fig. S8,  Fig. S9 from Flinn et al., 2020
pericardium edematous, abnormal WT + MO1-llgl1 Fig. S3 from Flinn et al., 2020
peridermal cell actin-based cell projection ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-llgl1 Fig. S2 from Magre et al., 2019
Fig. 3 with image,  Fig. 8 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased size, abnormal TU + MO1-llgl1 Fig. 5 with image from Raman et al., 2016
peridermal cell apical side ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 Fig. 3 with image from Raman et al., 2016
retina adherens junction distributed, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 3 with image,  Fig. S3 with image from Clark et al., 2012
retina adherens junction increased size, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 3 with image,  Fig. S3 with image from Clark et al., 2012
retina cell disorganized, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. S1 with image from Clark et al., 2012
retina layer formation delayed, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 1 with image from Clark et al., 2012
retinal neural layer structure, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 1 with image from Clark et al., 2012
retinal neural layer apical region increased area, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 4 with image from Clark et al., 2012
retinal neural layer cell aggregated, abnormal WT + MO1-llgl1 + MO4-tp53 Fig. 1 with image from Clark et al., 2012
Phenotype of all Fish created by or utilizing MO1-llgl1
Phenotype Fish Conditions Figures
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-llgl1 standard conditions Fig. S2 from Magre et al., 2019
Fig. 3 with image,  Fig. 8 with image from Raman et al., 2016
peridermal cell apical side ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 control Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased size, abnormal TU + MO1-llgl1 standard conditions Fig. 5 with image from Raman et al., 2016
peridermal cell actin-based cell projection ab1-llgl2 labeling decreased amount, abnormal TU + MO1-llgl1 control Fig. 3 with image from Raman et al., 2016
heart ccn2a expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart llgl2 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
pericardium edematous, abnormal WT + MO1-llgl1 standard conditions Fig. S3 from Flinn et al., 2020
cardiac muscle cell hypertrophic, abnormal WT + MO1-llgl1 standard conditions Fig. 3 with image from Flinn et al., 2020
heart valve morphology, abnormal WT + MO1-llgl1 standard conditions Fig. S6 from Flinn et al., 2020
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. S7 from Flinn et al., 2020
heart llgl1 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart valve morphogenesis process quality, abnormal WT + MO1-llgl1 standard conditions Fig. 5 with image,  Fig. S8,  Fig. S9 from Flinn et al., 2020
heart ccn1 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart hbegfa expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart pawr expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
cardiac muscle cell intercalated disc morphology, abnormal WT + MO1-llgl1 standard conditions Fig. S7 from Flinn et al., 2020
heart looping disrupted, abnormal WT + MO1-llgl1 standard conditions Fig. S5 from Flinn et al., 2020
heart lats2 expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
heart clu expression decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
cardiac ventricle cardiac muscle cell circular, abnormal WT + MO1-llgl1 standard conditions Fig. 3 with image,  Fig. S6 from Flinn et al., 2020
cardiac ventricle morphology, abnormal WT + MO1-llgl1 standard conditions Fig. S5 from Flinn et al., 2020
cardiac ventricle cardiac muscle cell Ab4-yap1 labeling decreased amount, abnormal WT + MO1-llgl1 standard conditions Fig. 6 with image from Flinn et al., 2020
retinal neural layer structure, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
eye decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retinal neural layer cell aggregated, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
heart decreased object quality, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
exit from mitosis decreased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
retina adherens junction distributed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. S3 with image from Clark et al., 2012
retinal neural layer apical region increased area, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 4 with image from Clark et al., 2012
retina layer formation delayed, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 1 with image from Clark et al., 2012
cell population proliferation increased occurrence, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 2 with image from Clark et al., 2012
retina cell disorganized, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
retina adherens junction increased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. S3 with image from Clark et al., 2012
brain decreased size, abnormal WT + MO1-llgl1 + MO4-tp53 standard conditions Fig. S1 with image from Clark et al., 2012
heart GFP expression increased distribution, abnormal mw43Tg + MO1-llgl1 standard conditions Fig. 5 with image from Flinn et al., 2020
epidermis cell cortex ab1-yap1 labeling decreased amount, abnormal mw43Tg + MO1-llgl1 standard conditions Fig. S10 from Flinn et al., 2020
heart GFP expression spatial pattern, abnormal mw43Tg + MO1-llgl1 standard conditions Fig. 5 with image from Flinn et al., 2020
peridermal cell actin-based cell projection decreased length, abnormal llgl2to6/to6 + MO1-llgl1 standard conditions Fig. 3 with image from Raman et al., 2016
peridermal cell apical side ab1-llgl2 labeling decreased amount, abnormal llgl2to6/to6 + MO1-llgl1 standard conditions Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection ab1-llgl2 labeling decreased amount, abnormal llgl2to6/to6 + MO1-llgl1 standard conditions Fig. 3 with image from Raman et al., 2016
peridermal cell actin-based cell projection length, ameliorated prkcim567/m567 + MO1-llgl1 standard conditions Fig. 5 with image from Raman et al., 2016
peridermal cell actin-based cell projection decreased length, abnormal TU + MO1-llgl1 + MO1-ranbp2 standard conditions Fig. S2 from Magre et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.