ZFIN ID: ZDB-MRPHLNO-100415-13
Morpholino Name: MO1-ifng1
Target: ifng1 (1)
Previous Names: MO1-ifng1-2, ifngamma1-2-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAAGGCGTTCGCTAAAGTTAGAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5' UTR of ifng1-2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ifng1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ifng1
Expressed Gene Anatomy Figures
ifngr1 Fig. 5 with image from Sawamiphak et al., 2014
mpx Fig. 3 with image from Sawamiphak et al., 2014
rag1 Fig. 3 with image from Sawamiphak et al., 2014
runx1 Fig. 1 with imageFig. 3 with image from Sawamiphak et al., 2014
PHENOTYPE
Phenotype resulting from MO1-ifng1
Phenotype Figures
defense response to bacterium disrupted, abnormal text only from Sieger et al., 2009
endothelial cell cell population proliferation increased rate, abnormal Fig. S4 with image from Sawamiphak et al., 2014
hematopoietic stem cell decreased amount, abnormal Fig. 1 with image from Sawamiphak et al., 2014
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal Fig. 1 with image from Sawamiphak et al., 2014

Phenotype of all Fish created by or utilizing MO1-ifng1
Phenotype Fish Conditions Figures
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 standard conditions text only from Sieger et al., 2009
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal kca3Tg; kca4Tg; la2Tg; s939Tg + MO1-ifng1 heat shock Fig. 4 with image from Sawamiphak et al., 2014
endothelial cell cell population proliferation increased rate, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. S4 with image from Sawamiphak et al., 2014
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. 1 with image from Sawamiphak et al., 2014
hematopoietic stem cell decreased amount, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. 1 with image from Sawamiphak et al., 2014
whole organism decreased life span, abnormal AB + MO1-ifng1 + MO1-ifng1r bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
OTHER MO1-ifng1 MORPHOLINO PAGESNo links to external sites
CITATIONS (5)