header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100415-13
Morpholino Name: MO1-ifng1
Target: ifng1 (1)
Previous Names: MO1-ifng1-2, ifngamma1-2-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAAGGCGTTCGCTAAAGTTAGAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5' UTR of ifng1-2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ifng1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ifng1
Expressed Gene Anatomy Figures
ifngr1 Fig. 5 with image from Sawamiphak et al., 2014
mpx Fig. 3 with image from Sawamiphak et al., 2014
rag1 Fig. 3 with image from Sawamiphak et al., 2014
runx1 Fig. 1 with imageFig. 3 with image from Sawamiphak et al., 2014
PHENOTYPE
Phenotype resulting from MO1-ifng1
Phenotype of all Fish created by or utilizing MO1-ifng1
Phenotype Fish Conditions Figures
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 standard conditions text only from Sieger et al., 2009
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal kca3Tg; kca4Tg; la2Tg; s939Tg + MO1-ifng1 heat shock Fig. 4 with image from Sawamiphak et al., 2014
endothelial cell cell population proliferation increased rate, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. S4 with image from Sawamiphak et al., 2014
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. 1 with image from Sawamiphak et al., 2014
hematopoietic stem cell decreased amount, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. 1 with image from Sawamiphak et al., 2014
whole organism decreased life span, abnormal AB + MO1-ifng1 + MO1-ifng1r bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
OTHER MO1-ifng1 MORPHOLINO PAGES No links to external sites
CITATIONS (5)