Morpholino

MO1-ifng1

ID
ZDB-MRPHLNO-100415-13
Name
MO1-ifng1
Previous Names
  • MO1-ifng1-2
  • ifngamma1-2-MO1 (1)
Target
Sequence
5' - TGAAGGCGTTCGCTAAAGTTAGAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5' UTR of ifng1-2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ifng1
Phenotype
Phenotype resulting from MO1-ifng1
Phenotype of all Fish created by or utilizing MO1-ifng1
Phenotype Fish Conditions Figures
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 standard conditions text only from Sieger et al., 2009
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal kca3Tg; kca4Tg; la2Tg; s939Tg + MO1-ifng1 heat shock Fig. 4 with image from Sawamiphak et al., 2014
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. 1 with image from Sawamiphak et al., 2014
endothelial cell cell population proliferation increased rate, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. S4 with image from Sawamiphak et al., 2014
hematopoietic stem cell decreased amount, abnormal la2Tg; s896Tg + MO1-ifng1 standard conditions Fig. 1 with image from Sawamiphak et al., 2014
whole organism decreased life span, abnormal AB + MO1-ifng1 + MO1-ifng1r bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
Citations