ZFIN ID: ZDB-MRPHLNO-100415-12
Morpholino Name: MO1-ifng1r
Target: ifng1r (1)
Previous Names: MO1-ifng1-1, ifngamma1-1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTCTGTGCTGTGAACCAAGTGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5' UTR of ifng1-1.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ifng1r No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ifng1r No data available
PHENOTYPE
Phenotype resulting from MO1-ifng1r
Phenotype of all Fish created by or utilizing MO1-ifng1r
Phenotype Fish Conditions Figures
defense response to bacterium disrupted, abnormal WT + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1r standard conditions text only from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism decreased life span, abnormal AB + MO1-ifng1 + MO1-ifng1r bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism decreased life span, abnormal AB + MO1-ifng1r + MO1-ifngr1 bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism decreased life span, abnormal AB + MO1-ifng1r + MO1-ifngr1l bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism decreased life span, abnormal AB + MO1-ifng1r + MO1-ifngr2 bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
Genome Resources:
CITATIONS (4)