Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-ifng1r

ID
ZDB-MRPHLNO-100415-12
Name
MO1-ifng1r
Previous Names
  • MO1-ifng1-1
  • ifngamma1-1-MO (1)
Target
Sequence
5' - TTTCTGTGCTGTGAACCAAGTGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5' UTR of ifng1-1.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ifng1r
No data available
Phenotype
Phenotype resulting from MO1-ifng1r
Phenotype of all Fish created by or utilizing MO1-ifng1r
Phenotype Fish Conditions Figures
defense response to bacterium disrupted, abnormal WT + MO1-ifng1r standard conditions text only from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism decreased life span, abnormal AB + MO1-ifng1 + MO1-ifng1r bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism decreased life span, abnormal AB + MO1-ifng1r + MO1-ifngr1 bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism decreased life span, abnormal AB + MO1-ifng1r + MO1-ifngr1l bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism decreased life span, abnormal AB + MO1-ifng1r + MO1-ifngr2 bacterial treatment: Yersinia ruckeri Fig. 3 from Aggad et al., 2010
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
whole organism viability, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Yersinia ruckeri Fig. 5 from Sieger et al., 2009
defense response to bacterium disrupted, abnormal WT + MO1-ifng1 + MO1-ifng1r bacterial treatment by injection: Escherichia coli DH5[alpha] Fig. 5 from Sieger et al., 2009
Citations