Morpholino

MO1-epas1b

ID
ZDB-MRPHLNO-100414-8
Name
MO1-epas1b
Previous Names
  • hif2a-MO (1)
Target
Sequence
5' - CGCTGTTCTCGCGTAATTCCCGCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-epas1b
Phenotype
Phenotype resulting from MO1-epas1b
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO1-epas1b Fig. 1 from Ko et al., 2011
brain neuron absent, abnormal WT + MO1-epas1b Fig. 2 from Ko et al., 2011
CaP motoneuron axon decreased length, abnormal rw0Tg + MO1-epas1b Fig. 5 with image from Lien et al., 2016
caudal fin cell population proliferation decreased process quality, abnormal as3Tg + MO1-epas1b Fig. 5 with image from Lin et al., 2014
central nervous system axon decreased amount, abnormal WT + MO1-epas1b Fig. 2 from Ko et al., 2011
exocrine pancreas decreased size, abnormal WT + MO1-epas1b Fig. 6 with image from Lin et al., 2014
G1 to G0 transition disrupted, abnormal WT + MO1-epas1b Fig. 4 from Ko et al., 2011
head decreased size, abnormal WT + MO1-epas1b Fig. 1Fig. 6 from Ko et al., 2011
liver leg1.1 expression decreased amount, abnormal WT + MO1-epas1b Fig. 9 with image from Lin et al., 2014
liver decreased size, abnormal WT + MO1-epas1b Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 10 with image from Lin et al., 2014
liver has fewer parts of type hepatocyte, abnormal as3Tg + MO1-epas1b Fig. 5 with image from Lin et al., 2014
liver cell population proliferation decreased process quality, abnormal as3Tg + MO1-epas1b Fig. 5 with image from Lin et al., 2014
motor neuron olig2 expression decreased amount, abnormal WT + MO1-epas1b Fig. 5 with image from Lien et al., 2016
motor neuron isl1a expression decreased amount, abnormal WT + MO1-epas1b Fig. 5 with image from Lien et al., 2016
neuron apoptotic process increased occurrence, abnormal WT + MO1-epas1b Fig. 1Fig. 6 from Ko et al., 2011
neuron differentiation disrupted, abnormal WT + MO1-epas1b Fig. 2Fig. 3Fig. 6 from Ko et al., 2011
neuronal stem cell decreased amount, abnormal WT + MO1-epas1b Fig. 2 from Ko et al., 2011
primary motor neuron decreased amount, abnormal rw0Tg + MO1-epas1b Fig. 5 with image from Lien et al., 2016
regulation of neuron apoptotic process disrupted, abnormal WT + MO1-epas1b + MO4-tp53 Fig. 1 from Ko et al., 2011
trunk cell population proliferation decreased process quality, abnormal as3Tg + MO1-epas1b Fig. 5 with image from Lin et al., 2014
whole organism leg1.1 expression decreased amount, abnormal WT + MO1-epas1b Fig. 9 with image from Lin et al., 2014
Phenotype of all Fish created by or utilizing MO1-epas1b
Phenotype Fish Conditions Figures
neuron apoptotic process increased occurrence, abnormal WT + MO1-epas1b standard conditions Fig. 1Fig. 6 from Ko et al., 2011
central nervous system axon decreased amount, abnormal WT + MO1-epas1b standard conditions Fig. 2 from Ko et al., 2011
neuronal stem cell decreased amount, abnormal WT + MO1-epas1b standard conditions Fig. 2 from Ko et al., 2011
head decreased size, abnormal WT + MO1-epas1b standard conditions Fig. 1Fig. 6 from Ko et al., 2011
liver decreased size, abnormal WT + MO1-epas1b standard conditions Fig. 2 with imageFig. 3 with image from Lin et al., 2014
regulation of neuron apoptotic process disrupted, abnormal WT + MO1-epas1b standard conditions Fig. 1 from Ko et al., 2011
motor neuron isl1a expression decreased amount, abnormal WT + MO1-epas1b standard conditions Fig. 5 with image from Lien et al., 2016
exocrine pancreas decreased size, abnormal WT + MO1-epas1b standard conditions Fig. 6 with image from Lin et al., 2014
G1 to G0 transition disrupted, abnormal WT + MO1-epas1b standard conditions Fig. 4 from Ko et al., 2011
motor neuron olig2 expression decreased amount, abnormal WT + MO1-epas1b standard conditions Fig. 5 with image from Lien et al., 2016
liver leg1.1 expression decreased amount, abnormal WT + MO1-epas1b standard conditions Fig. 9 with image from Lin et al., 2014
brain apoptotic, abnormal WT + MO1-epas1b standard conditions Fig. 1 from Ko et al., 2011
neuron differentiation disrupted, abnormal WT + MO1-epas1b standard conditions Fig. 2Fig. 3Fig. 6 from Ko et al., 2011
brain neuron absent, abnormal WT + MO1-epas1b standard conditions Fig. 2 from Ko et al., 2011
whole organism leg1.1 expression decreased amount, abnormal WT + MO1-epas1b standard conditions Fig. 9 with image from Lin et al., 2014
brain apoptotic, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
regulation of neuron apoptotic process disrupted, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
neuron apoptotic process increased occurrence, abnormal WT + MO1-epas1b + MO4-tp53 standard conditions Fig. 1 from Ko et al., 2011
liver has fewer parts of type hepatocyte, abnormal as3Tg + MO1-epas1b standard conditions Fig. 5 with image from Lin et al., 2014
liver cell population proliferation decreased process quality, abnormal as3Tg + MO1-epas1b standard conditions Fig. 5 with image from Lin et al., 2014
liver decreased size, abnormal as3Tg + MO1-epas1b standard conditions Fig. 5 with imageFig. 10 with image from Lin et al., 2014
trunk cell population proliferation decreased process quality, abnormal as3Tg + MO1-epas1b standard conditions Fig. 5 with image from Lin et al., 2014
caudal fin cell population proliferation decreased process quality, abnormal as3Tg + MO1-epas1b standard conditions Fig. 5 with image from Lin et al., 2014
primary motor neuron decreased amount, abnormal rw0Tg + MO1-epas1b standard conditions Fig. 5 with image from Lien et al., 2016
CaP motoneuron axon decreased length, abnormal rw0Tg + MO1-epas1b standard conditions Fig. 5 with image from Lien et al., 2016
brain apoptotic, abnormal tp53zdf1/zdf1 + MO1-epas1b standard conditions Fig. 1 from Ko et al., 2011
neuron apoptotic process increased occurrence, abnormal tp53zdf1/zdf1 + MO1-epas1b standard conditions Fig. 1 from Ko et al., 2011
regulation of neuron apoptotic process disrupted, abnormal tp53zdf1/zdf1 + MO1-epas1b standard conditions Fig. 1 from Ko et al., 2011
ventricular zone neuron projection decreased amount, abnormal WT + MO1-epas1b + MO1-hif1al + MO2-hif1ab standard conditions Fig. 5Fig. 7 from Hsieh et al., 2008
neuron apoptotic process increased occurrence, abnormal WT + MO1-epas1b + MO1-hif1al + MO2-hif1ab standard conditions Fig. 8 from Hsieh et al., 2008
forebrain apoptotic, abnormal WT + MO1-epas1b + MO1-hif1al + MO2-hif1ab standard conditions Fig. 8 from Hsieh et al., 2008
Citations