Morpholino

MO1-arrb1

ID

ZDB-MRPHLNO-100311-1

Name

MO1-arrb1

Previous Names

None

Target

arrb1 (1)

Sequence

5' - ACACCCTTGTGCCTTTATCTCCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-arrb1

No data available

Phenotype

Phenotype resulting from MO1-arrb1

Phenotype	Fish	Figures
brain decreased size, abnormal	WT + MO1-arrb1	Fig. S2 from Li et al., 2016
caudal fin curled, abnormal	WT + MO1-arrb1	Fig. S2 from Li et al., 2016
heart increased size, abnormal	WT + MO1-arrb1	Fig. S2 from Li et al., 2016
microglial cell cell body increased size, abnormal	zf147Tg + MO1-arrb1	Fig. 1 from Li et al., 2016
microglial cell cell body increased volume, abnormal	zf147Tg + MO1-arrb1	Fig. 1, Fig. 2 from Li et al., 2016
microglial cell cell projection increased amount, abnormal	zf147Tg + MO1-arrb1	Fig. 1, Fig. 2 from Li et al., 2016
microglial cell phagocytosis increased frequency, abnormal	ion8dTg; s1984tTg; zf147Tg + MO1-arrb1	Fig. 3 from Li et al., 2016
nucleate erythrocyte decreased amount, abnormal	WT + MO1-arrb1	Fig. 3 from Yue et al., 2009
optic tectum microglial cell morphology, abnormal	zf147Tg + MO1-arrb1	Fig. 1, Fig. 2 from Li et al., 2016
post-anal tail morphogenesis delayed, abnormal	WT + MO1-arrb1	Fig. 1 from Yue et al., 2009
post-vent region curved ventral, abnormal	WT + MO1-arrb1	Fig. 1 , Fig. 3 , Fig. 6 from Yue et al., 2009
ventral wall of dorsal aorta myb expression decreased amount, abnormal	TU + MO1-arrb1	Fig. 4 from Zhang et al., 2015
ventral wall of dorsal aorta hey2 expression increased amount, abnormal	TU + MO1-arrb1	Fig. 4 from Zhang et al., 2015
whole organism decreased length, abnormal	WT + MO1-arrb1	Fig. S2 from Li et al., 2016 Fig. 1 , Fig. 3 , Fig. 6 from Yue et al., 2009
whole organism necrotic, abnormal	WT + MO1-arrb1	Fig. 1 , Fig. 6 from Yue et al., 2009

Phenotype of all Fish created by or utilizing MO1-arrb1

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta myb expression decreased amount, abnormal	TU + MO1-arrb1	control	Fig. 4 from Zhang et al., 2015
ventral wall of dorsal aorta hey2 expression increased amount, abnormal	TU + MO1-arrb1	control	Fig. 4 from Zhang et al., 2015
caudal fin curled, abnormal	WT + MO1-arrb1	standard conditions	Fig. S2 from Li et al., 2016
heart increased size, abnormal	WT + MO1-arrb1	standard conditions	Fig. S2 from Li et al., 2016
post-vent region curved ventral, abnormal	WT + MO1-arrb1	standard conditions	Fig. 1 , Fig. 3 , Fig. 6 from Yue et al., 2009
brain decreased size, abnormal	WT + MO1-arrb1	standard conditions	Fig. S2 from Li et al., 2016
nucleate erythrocyte decreased amount, abnormal	WT + MO1-arrb1	standard conditions	Fig. 3 from Yue et al., 2009
whole organism necrotic, abnormal	WT + MO1-arrb1	standard conditions	Fig. 1 , Fig. 6 from Yue et al., 2009
whole organism decreased length, abnormal	WT + MO1-arrb1	standard conditions	Fig. S2 from Li et al., 2016 Fig. 1 , Fig. 3 , Fig. 6 from Yue et al., 2009
post-anal tail morphogenesis delayed, abnormal	WT + MO1-arrb1	standard conditions	Fig. 1 from Yue et al., 2009
microglial cell cell projection increased amount, abnormal	zf147Tg + MO1-arrb1	control	Fig. 1, Fig. 2 from Li et al., 2016
microglial cell cell body increased size, abnormal	zf147Tg + MO1-arrb1	control	Fig. 1 from Li et al., 2016
optic tectum microglial cell morphology, abnormal	zf147Tg + MO1-arrb1	control	Fig. 1, Fig. 2 from Li et al., 2016
microglial cell cell body increased volume, abnormal	zf147Tg + MO1-arrb1	control	Fig. 1, Fig. 2 from Li et al., 2016
microglial cell phagocytosis increased frequency, abnormal	ion8dTg; s1984tTg; zf147Tg + MO1-arrb1	control	Fig. 3 from Li et al., 2016

Citations