Morpholino

MO1-gnptab

ID
ZDB-MRPHLNO-100302-1
Name
MO1-gnptab
Previous Names
None
Target
Sequence
5' - TTAACGACCAACATGACTCCGGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gnptab
No data available
Phenotype
Phenotype resulting from MO1-gnptab
Phenotype Fish Figures
branchiostegal ray col1a2 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
branchiostegal ray sp7 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
branchiostegal ray disorganized, abnormal y1Tg + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2009
branchiostegal ray chondrocyte spheroid, abnormal y1Tg + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2009
cardiac chamber morphogenesis decreased process quality, abnormal f1Tg/f1Tg + MO1-gnptab Figure 2 with image from Lu et al., 2020
cardiac jelly spp1 expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
cardiac jelly acana expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
cardiac jelly acana expression spatial pattern, abnormal f1Tg/f1Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
cardiac jelly spp1 expression spatial pattern, abnormal f1Tg/f1Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
cardiac muscle cell EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab Figure 5 with image from Lu et al., 2020
cardiac muscle cell EGFP expression spatial pattern, abnormal f1Tg/f1Tg + MO1-gnptab Figure 2 with image from Lu et al., 2020
cardiac muscle cell RFP expression spatial pattern, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling decreased amount, abnormal AB + MO1-gnptab Figure 3 with imageFigure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling increased amount, abnormal f1Tg/f1Tg + MO1-gnptab Figure 3 with imageFigure 5 with image from Lu et al., 2020
ceratohyal cartilage col2a1a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
ceratohyal cartilage malformed, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2009
ceratohyal cartilage morphology, abnormal WT + MO1-gnptab Fig. 4 with imageFig. 7 with image from Flanagan-Steet et al., 2018
ceratohyal cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte ab3-smad2 labeling decreased amount, abnormal y1Tg + MO1-gnptab Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal y1Tg + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte mCherry expression increased amount, abnormal hu5910Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte Ab2-smad2/3 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte ab3-smad2 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
ceratohyal cartilage Collagen increased amount, abnormal y1Tg + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
chondrocyte Ab2-cspg4 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 6 with imageFig. 7 with image from Flanagan-Steet et al., 2018
chondrocyte nucleus ab3-smad2 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
chondrocyte nucleus Ab2-smad2/3 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
chondrocyte nucleus mCherry expression increased amount, abnormal ia15Tg; y1Tg + MO1-gnptab Fig. 7 with image from Flanagan-Steet et al., 2018
chondrocyte nucleus ab3-smad2 labeling mislocalised, abnormal y1Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
chondrocyte nucleus Ab2-smad2/3 labeling mislocalised, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
chondrocyte obsolete extracellular space ab1-ctsk labeling mislocalised, abnormal y1Tg + MO1-gnptab Fig. 6 from Flanagan-Steet et al., 2016
chondrocyte intercalation involved in growth plate cartilage morphogenesis disrupted, abnormal y1Tg + MO1-gnptab Fig. 5 from Flanagan-Steet et al., 2009
cleithrum col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
cleithrum sp7 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
cranial cartilage col2a1a expression increased amount, abnormal WT + MO1-gnptab Fig. 1Fig. 5 from Flanagan-Steet et al., 2016
cranial cartilage sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 5 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte dcn expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte hyperplastic, abnormal WT + MO1-gnptab Fig. 6 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte increased size, abnormal y1Tg + MO1-gnptab Fig. 5 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte development process quality, abnormal y1Tg + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
cranial cartilage collagen type II trimer increased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2009
cranial skeletal system development process quality, abnormal WT + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
dentary col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
dentary col1a2 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
dentary sp7 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
dentary runx2a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
dermatocranium runx2a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
dermatocranium col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2Fig. 5 from Flanagan-Steet et al., 2016
dermatocranium col1a2 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
dermatocranium ossification decreased occurrence, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
endocardium notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab Figure 2 with image from Lu et al., 2020
endochondral bone ossification decreased occurrence, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
entopterygoid col1a2 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
entopterygoid col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
head acana expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
head runx2a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
head col1a2 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
head col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
head dcn expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
head sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
head col2a1a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
heart BMP signaling pathway decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab Figure 3 with imageFigure 5 with image from Lu et al., 2020
heart looping decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab Figure 3 with image from Lu et al., 2020
heart valve malformed, abnormal f1Tg/f1Tg + MO1-gnptab Figure 2 with image from Lu et al., 2020
heart valve cell notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab Figure 2 with image from Lu et al., 2020
heart valve endothelial cell EGFP expression spatial pattern, abnormal s849Tg/s849Tg + MO1-gnptab Figure 5 with image from Lu et al., 2020
inner ear morphology, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2009
maxilla sp7 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
maxilla runx2a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
maxilla col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
Meckel's cartilage col2a1a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
Meckel's cartilage morphology, abnormal WT + MO1-gnptab Fig. 4 with imageFig. 7 with image from Flanagan-Steet et al., 2018
Meckel's cartilage chondrocyte ab1-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte Ab11-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte dcn expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte EGFP expression decreased amount, abnormal mw29Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte disorganized, abnormal y1Tg + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte Ab2-smad2/3 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte mCherry expression increased amount, abnormal hu5910Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte ab3-smad2 labeling increased amount, abnormal y1Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage Collagen increased amount, abnormal y1Tg + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
neurocranium blunt, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2009
opercle col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
osteoblast decreased amount, abnormal b1212Tg + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
otolith decreased size, abnormal WT + MO1-gnptab Fig. 7 from Flanagan-Steet et al., 2009
otolith mineralization disrupted, abnormal WT + MO1-gnptab Fig. 7 from Flanagan-Steet et al., 2009
palate col2a1a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
palatoquadrate cartilage decreased length, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2009
palatoquadrate cartilage sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte EGFP expression decreased amount, abnormal mw29Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte ab1-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte Ab11-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab Fig. 4 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
parasphenoid sp7 expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
parasphenoid col10a1a expression decreased amount, abnormal WT + MO1-gnptab Fig. 2 from Flanagan-Steet et al., 2016
peptidyl-serine phosphorylation increased occurrence, abnormal WT + MO1-gnptab Fig. 8 from Flanagan-Steet et al., 2009
pericardium edematous, abnormal WT + MO1-gnptab Figure 2 with imageFigure 3 with image from Lu et al., 2020
Fig. 1Fig. 7 from Flanagan-Steet et al., 2009
regulation of heart contraction decreased process quality, abnormal s849Tg/s849Tg + MO1-gnptab Figure 5 with image from Lu et al., 2020
splanchnocranium malformed, abnormal WT + MO1-gnptab Fig. 3 from Flanagan-Steet et al., 2016
transferase activity, transferring phosphorus-containing groups decreased process quality, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2016
ventral mandibular arch malformed, abnormal WT + MO1-gnptab Fig. 7 from Flanagan-Steet et al., 2009
ventral mandibular arch retracted, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2009
whole organism ab1-smad labeling decreased amount, abnormal WT + MO1-gnptab Fig. 4 with image from Flanagan-Steet et al., 2018
whole organism chst13 expression increased amount, abnormal WT + MO1-gnptab Fig. 6 with image from Flanagan-Steet et al., 2018
whole organism chst11 expression increased amount, abnormal WT + MO1-gnptab Fig. 6 with image from Flanagan-Steet et al., 2018
whole organism Ab9-smad2 labeling increased amount, abnormal WT + MO1-gnptab Fig. 4 with image from Flanagan-Steet et al., 2018
whole organism chst14 expression increased amount, abnormal WT + MO1-gnptab Fig. 6 with image from Flanagan-Steet et al., 2018
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2009
whole organism chondroitin sulfate amount, abnormal WT + MO1-gnptab Fig. 6 with image from Flanagan-Steet et al., 2018
yolk increased size, abnormal WT + MO1-gnptab Fig. 1 from Flanagan-Steet et al., 2009
Phenotype of all Fish created by or utilizing MO1-gnptab
Phenotype Fish Conditions Figures
heart valve malformed, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly spp1 expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling increased amount, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart valve cell notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac chamber morphogenesis decreased process quality, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling decreased amount, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac jelly spp1 expression spatial pattern, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac muscle cell EGFP expression spatial pattern, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly acana expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
endocardium notch1b expression mislocalised, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 2 with image from Lu et al., 2020
pericardium edematous, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 2 with image from Lu et al., 2020
cardiac jelly acana expression spatial pattern, abnormal f1Tg/f1Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart valve endothelial cell EGFP expression spatial pattern, abnormal s849Tg/s849Tg + MO1-gnptab standard conditions Figure 5 with image from Lu et al., 2020
regulation of heart contraction decreased process quality, abnormal s849Tg/s849Tg + MO1-gnptab standard conditions Figure 5 with image from Lu et al., 2020
heart valve endothelial cell EGFP expression spatial pattern, ameliorated s849Tg/s849Tg + MO1-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
regulation of heart contraction process quality, ameliorated s849Tg/s849Tg + MO1-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
pericardium edematous, abnormal s849Tg/s849Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
pericardium edematous, ameliorated s849Tg/s849Tg + MO1-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling amount, ameliorated AB + MO1-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling decreased amount, abnormal AB + MO1-gnptab standard conditions Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus ab1-smad labeling amount, ameliorated AB + MO1-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell nucleus Ab9-smad2 labeling increased amount, abnormal AB + MO1-gnptab standard conditions Figure 5 with image from Lu et al., 2020
cranial cartilage sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
parasphenoid col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
dentary runx2a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
Meckel's cartilage col2a1a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism chst14 expression increased amount, abnormal WT + MO1-gnptab control Fig. 6 with image from Flanagan-Steet et al., 2018
whole organism ab1-smad labeling amount, ameliorated WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 4 with image from Flanagan-Steet et al., 2018
whole organism ab1-smad labeling decreased amount, abnormal WT + MO1-gnptab control Fig. 4 with image from Flanagan-Steet et al., 2018
neurocranium blunt, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
ventral mandibular arch retracted, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
pericardium edematous, abnormal WT + MO1-gnptab standard conditions Fig. 1Fig. 7 from Flanagan-Steet et al., 2009
maxilla sp7 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte dcn expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
ceratohyal cartilage morphology, ameliorated WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 4 with image from Flanagan-Steet et al., 2018
cranial cartilage col2a1a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1Fig. 5 from Flanagan-Steet et al., 2016
transferase activity, transferring phosphorus-containing groups decreased process quality, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism arsb expression decreased amount, abnormal WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 6 with image from Flanagan-Steet et al., 2018
maxilla col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
whole organism chst13 expression decreased amount, abnormal WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 6 with image from Flanagan-Steet et al., 2018
otolith mineralization disrupted, abnormal WT + MO1-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
entopterygoid col1a2 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
splanchnocranium malformed, abnormal WT + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
dentary col1a2 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
dermatocranium runx2a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism chondroitin sulfate amount, abnormal WT + MO1-gnptab control Fig. 6 with image from Flanagan-Steet et al., 2018
whole organism chst11 expression decreased amount, abnormal WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 6 with image from Flanagan-Steet et al., 2018
palate col2a1a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism chst13 expression increased amount, abnormal WT + MO1-gnptab control Fig. 6 with image from Flanagan-Steet et al., 2018
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
entopterygoid col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
cranial skeletal system development process quality, abnormal WT + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
palatoquadrate cartilage decreased length, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
head col1a2 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
otolith decreased size, abnormal WT + MO1-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte development process quality, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
endochondral bone ossification decreased occurrence, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
dermatocranium col1a2 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
ventral mandibular arch malformed, abnormal WT + MO1-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
cleithrum sp7 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
dermatocranium ossification decreased occurrence, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
ceratohyal cartilage morphology, abnormal WT + MO1-gnptab control Fig. 4 with imageFig. 7 with image from Flanagan-Steet et al., 2018
parasphenoid sp7 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
ceratohyal cartilage malformed, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
opercle col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
maxilla runx2a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
whole organism Ab9-smad2 labeling amount, ameliorated WT + MO1-gnptab chemical treatment by environment: losartan Fig. 4 with image from Flanagan-Steet et al., 2018
branchiostegal ray sp7 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
head sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
dermatocranium col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2Fig. 5 from Flanagan-Steet et al., 2016
peptidyl-serine phosphorylation increased occurrence, abnormal WT + MO1-gnptab standard conditions Fig. 8 from Flanagan-Steet et al., 2009
Meckel's cartilage morphology, ameliorated WT + MO1-gnptab chemical treatment by environment: losartan Fig. 4 with image from Flanagan-Steet et al., 2018
head dcn expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism Ab9-smad2 labeling amount, ameliorated WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 4 with image from Flanagan-Steet et al., 2018
head col2a1a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
ceratohyal cartilage morphology, ameliorated WT + MO1-gnptab chemical treatment by environment: losartan Fig. 4 with image from Flanagan-Steet et al., 2018
Meckel's cartilage morphology, ameliorated WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 4 with image from Flanagan-Steet et al., 2018
head acana expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
cleithrum col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
branchiostegal ray col1a2 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
head col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
dentary col10a1a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
whole organism chst11 expression increased amount, abnormal WT + MO1-gnptab control Fig. 6 with image from Flanagan-Steet et al., 2018
yolk increased size, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
Meckel's cartilage chondrocyte dcn expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
inner ear morphology, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
palatoquadrate cartilage sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
Meckel's cartilage morphology, abnormal WT + MO1-gnptab control Fig. 4 with imageFig. 7 with image from Flanagan-Steet et al., 2018
dentary sp7 expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
ceratohyal cartilage col2a1a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte hyperplastic, abnormal WT + MO1-gnptab standard conditions Fig. 6 from Flanagan-Steet et al., 2009
whole organism chst14 expression decreased amount, abnormal WT + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 6 with image from Flanagan-Steet et al., 2018
Meckel's cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism ab1-smad labeling amount, ameliorated WT + MO1-gnptab chemical treatment by environment: losartan Fig. 4 with image from Flanagan-Steet et al., 2018
cranial cartilage chondrocyte acana expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
head runx2a expression decreased amount, abnormal WT + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte sox9a expression increased amount, abnormal WT + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
whole organism Ab9-smad2 labeling increased amount, abnormal WT + MO1-gnptab control Fig. 4 with image from Flanagan-Steet et al., 2018
osteoblast decreased amount, abnormal b1212Tg + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte mCherry expression increased amount, abnormal hu5910Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte mCherry expression increased amount, abnormal hu5910Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte EGFP expression decreased amount, abnormal mw29Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte EGFP expression decreased amount, abnormal mw29Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
chondrocyte nucleus ab3-smad2 labeling increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal y1Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte increased size, abnormal y1Tg + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2009
Meckel's cartilage Collagen increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte Ab2-smad2/3 labeling increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
chondrocyte nucleus Ab2-smad2/3 labeling mislocalised, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
cranial cartilage chondrocyte development process quality, abnormal y1Tg + MO1-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2016
chondrocyte Ab2-cspg4 labeling increased amount, abnormal y1Tg + MO1-gnptab control Fig. 6 with imageFig. 7 with image from Flanagan-Steet et al., 2018
chondrocyte obsolete extracellular space ab1-ctsk labeling mislocalised, abnormal y1Tg + MO1-gnptab standard conditions Fig. 6 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte ab1-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte ab1-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage Collagen increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte ab3-smad2 labeling increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte ab3-smad2 labeling decreased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte Ab2-smad2/3 labeling increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte Ab11-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
chondrocyte intercalation involved in growth plate cartilage morphogenesis disrupted, abnormal y1Tg + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2009
branchiostegal ray disorganized, abnormal y1Tg + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
Meckel's cartilage chondrocyte Ab11-smad labeling decreased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
chondrocyte nucleus Ab2-smad2/3 labeling increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte ab3-smad2 labeling increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2016
chondrocyte Ab2-cspg4 labeling decreased amount, abnormal y1Tg + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 6 with image from Flanagan-Steet et al., 2018
Meckel's cartilage chondrocyte disorganized, abnormal y1Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
branchiostegal ray chondrocyte spheroid, abnormal y1Tg + MO1-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
chondrocyte nucleus ab3-smad2 labeling mislocalised, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4Fig. 5 from Flanagan-Steet et al., 2016
cranial cartilage collagen type II trimer increased amount, abnormal y1Tg + MO1-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2009
cardiac muscle cell RFP expression spatial pattern, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
cardiac muscle cell EGFP expression amount, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell RFP expression spatial pattern, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
heart looping process quality, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
cardiac muscle cell nucleus EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
cardiac muscle cell GFP expression amount, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
heart BMP signaling pathway decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab standard conditions Figure 3 with imageFigure 5 with image from Lu et al., 2020
heart BMP signaling pathway process quality, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab chemical treatment by environment: EC 3.4.22.38 (cathepsin K) inhibitor Figure 5 with image from Lu et al., 2020
cardiac muscle cell EGFP expression decreased amount, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab standard conditions Figure 5 with image from Lu et al., 2020
heart BMP signaling pathway process quality, ameliorated ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab chemical treatment by environment: SB 505124 Figure 3 with image from Lu et al., 2020
heart looping decreased process quality, abnormal ggc3Tg/ggc3Tg; mw29Tg/mw29Tg + MO1-gnptab standard conditions Figure 3 with image from Lu et al., 2020
chondrocyte nucleus mCherry expression decreased amount, abnormal ia15Tg; y1Tg + MO1-gnptab chemical treatment by environment: SB 505124 Fig. 7 with image from Flanagan-Steet et al., 2018
chondrocyte nucleus mCherry expression increased amount, abnormal ia15Tg; y1Tg + MO1-gnptab control Fig. 7 with image from Flanagan-Steet et al., 2018
cranial skeletal system development occurrence, ameliorated sox9ahi1134Tg/hi1134Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
embryonic viscerocranium morphogenesis occurrence, ameliorated sox9ahi1134Tg/hi1134Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
splanchnocranium morphology, ameliorated sox9ahi1134Tg/hi1134Tg + MO1-gnptab standard conditions Fig. 3 from Flanagan-Steet et al., 2016
Meckel's cartilage morphology, ameliorated WT + MO1-chst11 + MO1-gnptab control Fig. 7 with image from Flanagan-Steet et al., 2018
ceratohyal cartilage morphology, ameliorated WT + MO1-chst11 + MO1-gnptab control Fig. 7 with image from Flanagan-Steet et al., 2018
dermatocranium col10a1a expression amount, ameliorated WT + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
cranial cartilage sox9a expression amount, ameliorated WT + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
cranial cartilage col2a1a expression amount, ameliorated WT + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte mCherry expression amount, ameliorated hu5910Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte mCherry expression amount, ameliorated hu5910Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte EGFP expression amount, ameliorated mw29Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte EGFP expression amount, ameliorated mw29Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
chondrocyte Ab2-cspg4 labeling decreased amount, abnormal y1Tg + MO1-chst11 + MO1-gnptab control Fig. 7 with image from Flanagan-Steet et al., 2018
Meckel's cartilage chondrocyte ab3-smad2 labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
Meckel's cartilage chondrocyte ab1-smad labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
ceratohyal cartilage chondrocyte ab3-smad2 labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
palatoquadrate cartilage chondrocyte ab1-smad labeling amount, ameliorated y1Tg + MO1-ctsk + MO1-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2016
chondrocyte nucleus mCherry expression decreased amount, abnormal ia15Tg; y1Tg + MO1-chst11 + MO1-gnptab control Fig. 7 with image from Flanagan-Steet et al., 2018
chondrocyte nucleus mCherry expression decreased amount, abnormal ia15Tg; y1Tg + MO1-ctsk + MO1-gnptab control Fig. 7 with image from Flanagan-Steet et al., 2018
Citations