Morpholino

MO1-bdnf

ID

ZDB-MRPHLNO-100205-1

Name

MO1-bdnf

Previous Names

None

Target

bdnf (1)

Sequence

5' - CCAGTCGTAAAGGAGACCATTCAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bdnf

Expressed Gene	Anatomy	Figures
bdnf	whole organism	Fig. 3 from Diekmann et al., 2009

Phenotype

Phenotype resulting from MO1-bdnf

Phenotype	Fish	Figures
activation of cysteine-type endopeptidase activity increased occurrence, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
axonogenesis disrupted, abnormal	mde4Tg + MO1-bdnf (AB)	Fig. 4 from Barbereau et al., 2020
cranial nerve II aplastic, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
eye decreased size, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
head decreased size, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
locomotion decreased process quality, abnormal	WT + MO1-bdnf	text only from Shimada et al., 2012
motor neuron neuron projection truncated, abnormal	rw0Tg + MO1-bdnf	Fig. 5 from Mastrodonato et al., 2019
pericardium swollen, abnormal	WT + MO1-bdnf	text only from Shimada et al., 2012
swim bladder aplastic, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
ventral mandibular arch malformed, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
ventricular system increased size, abnormal	AB + MO1-bdnf	Fig. 4 from Diekmann et al., 2009
whole organism Ab5-bdnf labeling decreased amount, abnormal	mde4Tg + MO1-bdnf (AB)	Fig. 2 from Barbereau et al., 2020
whole organism ab1-ntrk2 labeling decreased amount, abnormal	mde4Tg + MO1-bdnf (AB)	Fig. 2 from Barbereau et al., 2020

Phenotype of all Fish created by or utilizing MO1-bdnf

Phenotype	Fish	Conditions	Figures
activation of cysteine-type endopeptidase activity increased occurrence, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
head decreased size, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
ventral mandibular arch malformed, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
ventricular system increased size, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
eye decreased size, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
swim bladder aplastic, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal	AB + MO1-bdnf	standard conditions	Fig. 4 from Diekmann et al., 2009
locomotion decreased process quality, abnormal	WT + MO1-bdnf	standard conditions	text only from Shimada et al., 2012
pericardium swollen, abnormal	WT + MO1-bdnf	standard conditions	text only from Shimada et al., 2012
whole organism Ab5-bdnf labeling decreased amount, abnormal	mde4Tg + MO1-bdnf (AB)	standard conditions	Fig. 2 from Barbereau et al., 2020
axonogenesis disrupted, abnormal	mde4Tg + MO1-bdnf (AB)	standard conditions	Fig. 4 from Barbereau et al., 2020
whole organism ab1-ntrk2 labeling decreased amount, abnormal	mde4Tg + MO1-bdnf (AB)	standard conditions	Fig. 2 from Barbereau et al., 2020
motor neuron neuron projection truncated, abnormal	rw0Tg + MO1-bdnf	standard conditions	Fig. 5 from Mastrodonato et al., 2019
Rohon-Beard neuron axon decreased length, abnormal	WT + MO1-bdnf + MO3-mecp2	standard conditions	Fig. 8 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal	WT + MO1-bdnf + MO3-mecp2	standard conditions	Fig. 8 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal	WT + MO1-bdnf + MO3-mecp2	standard conditions	Fig. 8 from Nozawa et al., 2017

Citations