Morpholino

MO3-lef1

ID
ZDB-MRPHLNO-100125-1
Name
MO3-lef1
Previous Names
None
Target
Sequence
5' - CTCCACCTGACAACTGCGGCATTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lef1
No data available
Phenotype
Phenotype resulting from MO3-lef1
Phenotype of all Fish created by or utilizing MO3-lef1
Phenotype Fish Conditions Figures
posterior lateral line neuromast decreased amount, abnormal WT + MO3-lef1 standard conditions Fig. 1 with image from Valdivia et al., 2011
neuromast has fewer parts of type neuromast hair cell, abnormal WT + MO3-lef1 standard conditions Fig. 2 with image from Wada et al., 2013
posterior lateral line development decreased process quality, abnormal WT + MO3-lef1 standard conditions Fig. 1 with image from Valdivia et al., 2011
Wnt signaling pathway decreased process quality, abnormal ia4Tg + MO3-lef1 standard conditions Fig. 1 with image from Valdivia et al., 2011
posterior lateral line development decreased process quality, abnormal zf106Tg + MO3-lef1 standard conditions Fig. 4 with image from Valdivia et al., 2011
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO3-lef1 standard conditions Fig. 4 with image from Valdivia et al., 2011
neuromast decreased distance neuromast, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 1 with image from Matsuda et al., 2013
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 3 with image from Matsuda et al., 2013
neuromast deposition process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 1 with imageFig. 3 with image from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal zf106Tg + MO3-lef1 + MO4-tp53 standard conditions Fig. 2 with image from Matsuda et al., 2013
pectoral fin decreased size, abnormal tcf7nkhg21cEt/nkhg21cEt + MO3-lef1 standard conditions Fig. 4 with image from Nagayoshi et al., 2008
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated amotl2afu46/fu46; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Agarwala et al., 2015
posterior lateral line development decreased process quality, abnormal apczf134/zf134; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Valdivia et al., 2011
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal yap1fu48/fu48; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Agarwala et al., 2015
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal amotl2afu46/fu46; yap1fu48/fu48; zf106Tg + MO3-lef1 standard conditions Fig. 7 with image from Agarwala et al., 2015
Citations