Morpholino

MO3-lef1

ID

ZDB-MRPHLNO-100125-1

Name

MO3-lef1

Previous Names

None

Target

lef1 (1)

Sequence

5' - CTCCACCTGACAACTGCGGCATTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-lef1

Expressed Gene	Anatomy	Figures
dlx2a	apical ectodermal ridge pectoral fin bud pectoral fin bud	Fig. 4 from Nagayoshi et al., 2008
fgf8a	fin fold pectoral fin bud	Fig. 4 from Nagayoshi et al., 2008
fgf10a	mesenchyme pectoral fin pectoral fin bud mesenchyme	Fig. 4 from Nagayoshi et al., 2008
fgf24	apical ectodermal ridge pectoral fin bud	Fig. 4 from Nagayoshi et al., 2008
wnt3a	apical ectodermal ridge pectoral fin bud	Fig. 4 from Nagayoshi et al., 2008

Phenotype

Phenotype resulting from MO3-lef1

Phenotype	Fish	Figures
neuromast decreased distance neuromast, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	Fig. 1 from Matsuda et al., 2013
neuromast has fewer parts of type neuromast hair cell, abnormal	WT + MO3-lef1	Fig. 2 from Wada et al., 2013
neuromast deposition process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	Fig. 1 , Fig. 3 from Matsuda et al., 2013
posterior lateral line development decreased process quality, abnormal	zf106Tg + MO3-lef1	Fig. 1 , Fig. 4 from Valdivia et al., 2011
posterior lateral line neuromast decreased amount, abnormal	WT + MO3-lef1	Fig. 1 , Fig. 4 from Valdivia et al., 2011
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	Fig. 3 from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	Fig. 2 from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	Fig. 2 from Matsuda et al., 2013
Wnt signaling pathway decreased process quality, abnormal	ia4Tg + MO3-lef1	Fig. 1 from Valdivia et al., 2011

Phenotype of all Fish created by or utilizing MO3-lef1

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast decreased amount, abnormal	WT + MO3-lef1	standard conditions	Fig. 1 from Valdivia et al., 2011
neuromast has fewer parts of type neuromast hair cell, abnormal	WT + MO3-lef1	standard conditions	Fig. 2 from Wada et al., 2013
posterior lateral line development decreased process quality, abnormal	WT + MO3-lef1	standard conditions	Fig. 1 from Valdivia et al., 2011
Wnt signaling pathway decreased process quality, abnormal	ia4Tg + MO3-lef1	standard conditions	Fig. 1 from Valdivia et al., 2011
posterior lateral line development decreased process quality, abnormal	zf106Tg + MO3-lef1	standard conditions	Fig. 4 from Valdivia et al., 2011
posterior lateral line neuromast decreased amount, abnormal	zf106Tg + MO3-lef1	standard conditions	Fig. 4 from Valdivia et al., 2011
neuromast decreased distance neuromast, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	standard conditions	Fig. 1 from Matsuda et al., 2013
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	standard conditions	Fig. 3 from Matsuda et al., 2013
neuromast deposition process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	standard conditions	Fig. 1 , Fig. 3 from Matsuda et al., 2013
posterior lateral line primordium cell division decreased process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	standard conditions	Fig. 2 from Matsuda et al., 2013
posterior lateral line primordium cell population proliferation decreased process quality, abnormal	zf106Tg + MO3-lef1 + MO4-tp53	standard conditions	Fig. 2 from Matsuda et al., 2013
pectoral fin decreased size, abnormal	tcf7^{nkhg21cEt/nkhg21cEt} + MO3-lef1	standard conditions	Fig. 4 from Nagayoshi et al., 2008
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated	amotl2a^fu46/fu46; zf106Tg + MO3-lef1	standard conditions	Fig. 7 from Agarwala et al., 2015
posterior lateral line development decreased process quality, abnormal	apc^zf134/zf134; zf106Tg + MO3-lef1	standard conditions	Fig. 7 from Valdivia et al., 2011
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal	yap1^fu48/fu48; zf106Tg + MO3-lef1	standard conditions	Fig. 7 from Agarwala et al., 2015
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal	amotl2a^fu46/fu46; yap1^fu48/fu48; zf106Tg + MO3-lef1	standard conditions	Fig. 7 from Agarwala et al., 2015

Citations