Morpholino

MO1-jupa

ID

ZDB-MRPHLNO-091103-3

Name

MO1-jupa

Previous Names

MO1-jup

Target

jupa (1)

Sequence

5' - GAGCCTCTCCCATGTGCATTTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-jupa

No data available

Phenotype

Phenotype resulting from MO1-jupa

Phenotype	Fish	Figures
atrioventricular valve development disrupted, abnormal	AB + MO1-jupa	Fig. 5 from Martin et al., 2009
blood circulation disrupted, abnormal	AB + MO1-jupa	Fig. 1 , Fig. 6 from Martin et al., 2009
heart decreased size, abnormal	AB + MO1-jupa	Fig. 1 from Martin et al., 2009
heart edematous, abnormal	AB + MO1-jupa	Fig. 1 , Fig. 2 from Martin et al., 2009
heart adherens junction composition, abnormal	AB + MO1-jupa	Fig. 8 from Martin et al., 2009
heart adherens junction decreased amount, abnormal	AB + MO1-jupa	Fig. 9 from Martin et al., 2009
heart cell-cell junction decreased amount, abnormal	AB + MO1-jupa	text only from Martin et al., 2009
heart cell-cell junction structure, abnormal	AB + MO1-jupa	Fig. 9 from Martin et al., 2009
heart desmosome decreased amount, abnormal	AB + MO1-jupa	Fig. 9 from Martin et al., 2009
heart endothelial cell morphology, abnormal	AB + MO1-jupa	Fig. 5 from Martin et al., 2009
Kupffer's vesicle anatomical space decreased volume, abnormal	AB + MO1-jupa + MO4-tp53	Fig. 5 from Dasgupta et al., 2018
Kupffer's vesicle tight junction structure, abnormal	AB + MO1-jupa + MO4-tp53	Fig. 5 from Dasgupta et al., 2018
midbrain-hindbrain boundary development disrupted, abnormal	AB + MO1-jupa	Fig. 1 from Martin et al., 2009
nucleate erythrocyte decreased amount, abnormal	AB + MO1-jupa	Fig. 6 from Martin et al., 2009
post-vent region kinked, abnormal	AB + MO1-jupa	Fig. 1 from Martin et al., 2009

Phenotype of all Fish created by or utilizing MO1-jupa

Phenotype	Fish	Conditions	Figures
midbrain-hindbrain boundary development disrupted, abnormal	AB + MO1-jupa	standard conditions	Fig. 1 from Martin et al., 2009
heart cell-cell junction structure, abnormal	AB + MO1-jupa	standard conditions	Fig. 9 from Martin et al., 2009
heart edematous, abnormal	AB + MO1-jupa	standard conditions	Fig. 1 , Fig. 2 from Martin et al., 2009
heart decreased size, abnormal	AB + MO1-jupa	standard conditions	Fig. 1 from Martin et al., 2009
blood circulation disrupted, abnormal	AB + MO1-jupa	standard conditions	Fig. 1 , Fig. 6 from Martin et al., 2009
heart endothelial cell morphology, abnormal	AB + MO1-jupa	standard conditions	Fig. 5 from Martin et al., 2009
heart adherens junction composition, abnormal	AB + MO1-jupa	standard conditions	Fig. 8 from Martin et al., 2009
post-vent region kinked, abnormal	AB + MO1-jupa	standard conditions	Fig. 1 from Martin et al., 2009
heart cell-cell junction decreased amount, abnormal	AB + MO1-jupa	standard conditions	text only from Martin et al., 2009
nucleate erythrocyte decreased amount, abnormal	AB + MO1-jupa	standard conditions	Fig. 6 from Martin et al., 2009
heart desmosome decreased amount, abnormal	AB + MO1-jupa	standard conditions	Fig. 9 from Martin et al., 2009
atrioventricular valve development disrupted, abnormal	AB + MO1-jupa	standard conditions	Fig. 5 from Martin et al., 2009
heart adherens junction decreased amount, abnormal	AB + MO1-jupa	standard conditions	Fig. 9 from Martin et al., 2009
Kupffer's vesicle anatomical space decreased volume, abnormal	AB + MO1-jupa + MO4-tp53	standard conditions	Fig. 5 from Dasgupta et al., 2018
Kupffer's vesicle tight junction structure, abnormal	AB + MO1-jupa + MO4-tp53	standard conditions	Fig. 5 from Dasgupta et al., 2018

Citations