header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-091103-3
Morpholino Name: MO1-jupa
Target: jupa (1)
Previous Name: MO1-jup

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGCCTCTCCCATGTGCATTTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-jupa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-jupa
Expressed Gene Anatomy Figures
bmp2b Fig. 7 with image from Martin et al., 2009
bmp4 Fig. 4 with imageFig. 7 with image from Martin et al., 2009
dharma Fig. 7 with image from Martin et al., 2009
jupa Fig. 1 with image from Martin et al., 2009
myh7 Fig. 4 with image from Martin et al., 2009
myl7 Fig. 4 with image from Martin et al., 2009
ndr1 Fig. 7 with image from Martin et al., 2009
nkx2.5 Fig. 4 with image from Martin et al., 2009
notch1b Fig. 4 with image from Martin et al., 2009
PHENOTYPE
Phenotype resulting from MO1-jupa
Phenotype of all Fish created by or utilizing MO1-jupa
Phenotype Fish Conditions Figures
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-jupa standard conditions Fig. 1 with image from Martin et al., 2009
heart cell-cell junction structure, abnormal AB + MO1-jupa standard conditions Fig. 9 with image from Martin et al., 2009
heart edematous, abnormal AB + MO1-jupa standard conditions Fig. 1 with imageFig. 2 with image from Martin et al., 2009
heart decreased size, abnormal AB + MO1-jupa standard conditions Fig. 1 with image from Martin et al., 2009
blood circulation disrupted, abnormal AB + MO1-jupa standard conditions Fig. 1 with imageFig. 6 with image from Martin et al., 2009
heart endothelial cell morphology, abnormal AB + MO1-jupa standard conditions Fig. 5 with image from Martin et al., 2009
heart adherens junction composition, abnormal AB + MO1-jupa standard conditions Fig. 8 with image from Martin et al., 2009
post-vent region kinked, abnormal AB + MO1-jupa standard conditions Fig. 1 with image from Martin et al., 2009
heart cell-cell junction decreased amount, abnormal AB + MO1-jupa standard conditions text only from Martin et al., 2009
nucleate erythrocyte decreased amount, abnormal AB + MO1-jupa standard conditions Fig. 6 with image from Martin et al., 2009
heart desmosome decreased amount, abnormal AB + MO1-jupa standard conditions Fig. 9 with image from Martin et al., 2009
atrioventricular valve development disrupted, abnormal AB + MO1-jupa standard conditions Fig. 5 with image from Martin et al., 2009
heart adherens junction decreased amount, abnormal AB + MO1-jupa standard conditions Fig. 9 with image from Martin et al., 2009
Kupffer's vesicle anatomical space decreased volume, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
Kupffer's vesicle tight junction structure, abnormal AB + MO1-jupa + MO4-tp53 standard conditions Fig. 5 with image from Dasgupta et al., 2018
OTHER MO1-jupa MORPHOLINO PAGESNo links to external sites
CITATIONS (3)