Morpholino

MO3-nkx2.7

ID
ZDB-MRPHLNO-090916-1
Name
MO3-nkx2.7
Previous Names
None
Target
Sequence
5' - GTCACAGGACTCGGAAGCATCGTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Morpholino blocks the translation of nkx2.7
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nkx2.7
Expressed Gene Anatomy Figures
bmp4 Fig. 5 with image from Tu et al., 2009
nkx2.5 Fig. 2 with image from Tu et al., 2009
tbx5a Fig. 6 with image from Tu et al., 2009
tbx20 Fig. 6 with image from Tu et al., 2009
vcana Fig. 5 with image from Tu et al., 2009
Phenotype
Phenotype resulting from MO3-nkx2.7
Phenotype Fish Figures
cardiac muscle cell differentiation disrupted, abnormal AB + MO3-nkx2.7 Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
cardiac ventricle hypotrophic, abnormal twu34Tg + MO3-nkx2.7 text only from Tu et al., 2009
cardiac ventricle morphology, abnormal AB + MO3-nkx2.7 Fig. 2 with image from Tu et al., 2009
heart morphology, abnormal twu34Tg + MO3-nkx2.7 text only from Tu et al., 2009
heart contraction arrhythmic, abnormal twu34Tg + MO3-nkx2.7 text only from Tu et al., 2009
heart development disrupted, abnormal AB + MO3-nkx2.7 Fig. 1 with image,  Fig. 5 with image,  Fig. 6 with image,  text only from Tu et al., 2009
heart looping disrupted, abnormal twu34Tg + MO3-nkx2.7 Fig. 1 with image,  text only from Tu et al., 2009
heart morphogenesis disrupted, abnormal AB + MO3-nkx2.7 Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
pericardium edematous, abnormal twu34Tg + MO3-nkx2.7 text only from Tu et al., 2009
Phenotype of all Fish created by or utilizing MO3-nkx2.7
Phenotype Fish Conditions Figures
heart development disrupted, abnormal AB + MO3-nkx2.7 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
cardiac ventricle morphology, abnormal AB + MO3-nkx2.7 standard conditions Fig. 2 with image from Tu et al., 2009
cardiac muscle cell differentiation disrupted, abnormal AB + MO3-nkx2.7 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
heart morphogenesis disrupted, abnormal AB + MO3-nkx2.7 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
heart looping disrupted, abnormal twu34Tg + MO3-nkx2.7 standard conditions Fig. 1 with image,  text only from Tu et al., 2009
pericardium edematous, abnormal twu34Tg + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
cardiac ventricle hypotrophic, abnormal twu34Tg + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
heart development disrupted, abnormal twu34Tg + MO3-nkx2.7 standard conditions Fig. 1 with image,  text only from Tu et al., 2009
heart morphology, abnormal twu34Tg + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
heart contraction arrhythmic, abnormal twu34Tg + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
heart morphogenesis disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image,  Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
ventricular myocardium decreased thickness, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
heart decreased size, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
cardiac muscle cell differentiation disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
endocardial cushion aplastic, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
cardiac ventricle hypotrophic, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
cardiac muscle cell proliferation disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
heart development disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 5 with image,  Fig. 6 with image from Tu et al., 2009
ventricular myocardium cardiac muscle cell decreased amount, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
atrium distended, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with image from Tu et al., 2009
heart looping disrupted, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with image,  text only from Tu et al., 2009
cardiac ventricle hypotrophic, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with image,  text only from Tu et al., 2009
pericardium edematous, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
heart contraction arrhythmic, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
heart development disrupted, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with image,  text only from Tu et al., 2009
heart morphology, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.