Morpholino

MO4-wnt5b

ID
ZDB-MRPHLNO-090915-1
Name
MO4-wnt5b
Previous Names
  • wnt5 MO (1)
Target
Sequence
5' - GCAAACACAATAATTTCTTACCACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-wnt5b
Expressed Gene Anatomy Figures
egr2b Fig. 3 from Lin et al., 2010
myod1 Fig. 3 from Lin et al., 2010
pax2a Fig. 3 from Lin et al., 2010
Phenotype
Phenotype resulting from MO4-wnt5b
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO4-wnt5b Fig. 7 from Cirone et al., 2008
anterior cerebral vein decreased size, abnormal y1Tg + MO4-wnt5b text only from Cirone et al., 2008
anterior cerebral vein morphology, abnormal y1Tg + MO4-wnt5b text only from Cirone et al., 2008
common cardinal vein morphology, abnormal y1Tg + MO4-wnt5b text only from Cirone et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO4-wnt5b Fig. 3 from Lin et al., 2010
intersegmental vessel morphology, abnormal y1Tg + MO4-wnt5b Fig. 7 from Cirone et al., 2008
mid cerebral vein decreased size, abnormal y1Tg + MO4-wnt5b text only from Cirone et al., 2008
retina layer formation disrupted, abnormal knu3Tg + MO4-wnt5b Fig. 2 from Lin et al., 2010
retinal inner plexiform layer disorganized, abnormal knu3Tg + MO4-wnt5b Fig. 2 from Lin et al., 2010
somite condensed, abnormal WT + MO4-wnt5b Fig. 2,  Fig. 3 from Lin et al., 2010
trunk decreased length, abnormal WT + MO4-wnt5b Fig. 2,  Fig. 3 from Lin et al., 2010
trunk somite increased width, abnormal WT + MO4-wnt5b Fig. 3 from Lin et al., 2010
Wnt signaling pathway, calcium modulating pathway disrupted, abnormal WT + MO4-wnt5b Fig. 5 with image,  Fig. S2 with image from Freisinger et al., 2010
Phenotype of all Fish created by or utilizing MO4-wnt5b
Phenotype Fish Conditions Figures
trunk decreased length, abnormal WT + MO4-wnt5b standard conditions Fig. 2,  Fig. 3 from Lin et al., 2010
convergent extension involved in axis elongation disrupted, abnormal WT + MO4-wnt5b standard conditions Fig. 3 from Lin et al., 2010
trunk somite increased width, abnormal WT + MO4-wnt5b standard conditions Fig. 3 from Lin et al., 2010
Wnt signaling pathway, calcium modulating pathway disrupted, abnormal WT + MO4-wnt5b standard conditions Fig. 5 with image,  Fig. S2 with image from Freisinger et al., 2010
somite condensed, abnormal WT + MO4-wnt5b standard conditions Fig. 2,  Fig. 3 from Lin et al., 2010
retinal inner plexiform layer disorganized, abnormal knu3Tg + MO4-wnt5b standard conditions Fig. 2 from Lin et al., 2010
retina layer formation disrupted, abnormal knu3Tg + MO4-wnt5b standard conditions Fig. 2 from Lin et al., 2010
anterior cerebral vein decreased size, abnormal y1Tg + MO4-wnt5b standard conditions text only from Cirone et al., 2008
mid cerebral vein decreased size, abnormal y1Tg + MO4-wnt5b standard conditions text only from Cirone et al., 2008
common cardinal vein morphology, abnormal y1Tg + MO4-wnt5b standard conditions text only from Cirone et al., 2008
angiogenesis disrupted, abnormal y1Tg + MO4-wnt5b standard conditions Fig. 7 from Cirone et al., 2008
anterior cerebral vein morphology, abnormal y1Tg + MO4-wnt5b standard conditions text only from Cirone et al., 2008
intersegmental vessel morphology, abnormal y1Tg + MO4-wnt5b standard conditions Fig. 7 from Cirone et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-ryk + MO4-wnt5b standard conditions Fig. 3,  Fig. 5 from Lin et al., 2010
trunk somite increased width, abnormal WT + MO1-ryk + MO4-wnt5b standard conditions Fig. 3 from Lin et al., 2010
dorsal convergence disrupted, abnormal WT + MO1-ryk + MO4-wnt5b standard conditions Fig. 5 from Lin et al., 2010
somite condensed, abnormal WT + MO1-ryk + MO4-wnt5b standard conditions Fig. 3 from Lin et al., 2010
trunk decreased length, abnormal WT + MO1-ryk + MO4-wnt5b standard conditions Fig. 3 from Lin et al., 2010
whole organism decreased length, abnormal WT + MO3-rgs3a + MO4-wnt5b standard conditions Fig. 6 with image from Freisinger et al., 2010
somite development disrupted, abnormal WT + MO3-rgs3a + MO4-wnt5b standard conditions Fig. 6 with image from Freisinger et al., 2010
Wnt signaling pathway, calcium modulating pathway disrupted, abnormal WT + MO3-rgs3a + MO4-wnt5b standard conditions Fig. 5 with image from Freisinger et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.