Morpholino

MO4-olig2

ID
ZDB-MRPHLNO-090821-5
Name
MO4-olig2
Previous Names
None
Target
Sequence
5' - ACACTCGGCTCGTGTCAGAGTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-olig2
Expressed Gene Anatomy Figures
cxcl12a Fig. 6 with image from Zannino et al., 2012
egr2b Fig. 2 with image from Zannino et al., 2012
hoxb1a Fig. 2 with image from Zannino et al., 2012
hoxb4a Fig. 2 with image from Zannino et al., 2012
nkx6.1 Fig. 8 from Zannino et al., 2009
sox10 Fig. 6 from Zannino et al., 2009
Phenotype
Phenotype resulting from MO4-olig2
Phenotype Fish Figures
abducens nucleus development disrupted, abnormal vu12Tg + MO4-olig2 Fig. 6 from Zannino et al., 2009
cell differentiation in hindbrain disrupted, abnormal vu12Tg + MO4-olig2 Fig. 8 from Zannino et al., 2009
cranial nerve VI motor neuron decreased amount, abnormal vu12Tg + MO4-olig2 Fig. 6 from Zannino et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal rw0Tg + MO4-olig2 Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Zannino et al., 2012
hindbrain glioblast (sensu Vertebrata) decreased amount, abnormal vu12Tg + MO4-olig2 Fig. 6 from Zannino et al., 2009
neuron differentiation disrupted, abnormal vu12Tg + MO4-olig2 Fig. 8 from Zannino et al., 2009
neuron migration disrupted, abnormal rw0Tg + MO4-olig2 Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Zannino et al., 2012
oligodendrocyte decreased amount, abnormal vu12Tg + MO4-olig2 text only from Zannino et al., 2009
oligodendrocyte differentiation disrupted, abnormal vu12Tg + MO4-olig2 Fig. 8 from Zannino et al., 2009
spinal cord motor neuron decreased amount, abnormal vu12Tg + MO4-olig2 text only from Zannino et al., 2009
Phenotype of all Fish created by or utilizing MO4-olig2
Phenotype Fish Conditions Figures
facial nerve motor nucleus motor neuron mislocalised, abnormal rw0Tg + MO4-olig2 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Zannino et al., 2012
neuron migration disrupted, abnormal rw0Tg + MO4-olig2 standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 5 with image from Zannino et al., 2012
oligodendrocyte differentiation disrupted, abnormal vu12Tg + MO4-olig2 standard conditions Fig. 8 from Zannino et al., 2009
oligodendrocyte decreased amount, abnormal vu12Tg + MO4-olig2 standard conditions text only from Zannino et al., 2009
abducens nucleus development disrupted, abnormal vu12Tg + MO4-olig2 standard conditions Fig. 6 from Zannino et al., 2009
hindbrain glioblast (sensu Vertebrata) decreased amount, abnormal vu12Tg + MO4-olig2 standard conditions Fig. 6 from Zannino et al., 2009
cell differentiation in hindbrain disrupted, abnormal vu12Tg + MO4-olig2 standard conditions Fig. 8 from Zannino et al., 2009
neuron differentiation disrupted, abnormal vu12Tg + MO4-olig2 standard conditions Fig. 8 from Zannino et al., 2009
cranial nerve VI motor neuron decreased amount, abnormal vu12Tg + MO4-olig2 standard conditions Fig. 6 from Zannino et al., 2009
spinal cord motor neuron decreased amount, abnormal vu12Tg + MO4-olig2 standard conditions text only from Zannino et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.