ZFIN ID: ZDB-MRPHLNO-090820-3
Morpholino Name: MO1-ncapg
Target: ncapg (1)
Sequence:
5' - CAGATCCGCGTCTCCAGGCATGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 4 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ncapg No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ncapg No data available
PHENOTYPE
Phenotype resulting from MO1-ncapg
Phenotype Figures
gastrula cell chromosome morphology, abnormal Fig. 4 with image from Seipold et al., 2009
mitotic sister chromatid segregation disrupted, abnormal Fig. 4 with image from Seipold et al., 2009
whole organism lethal (sensu genetics), abnormal text only from Seipold et al., 2009

Phenotype of all Fish created by or utilizing MO1-ncapg
Phenotype Fish Conditions Figures
whole organism lethal (sensu genetics), abnormal WT + MO1-ncapg standard conditions text only from Seipold et al., 2009
gastrula cell chromosome morphology, abnormal kca66Tg; kca6Tg + MO1-ncapg + MO4-tp53 standard conditions Fig. 4 with image from Seipold et al., 2009
mitotic sister chromatid segregation disrupted, abnormal kca66Tg; kca6Tg + MO1-ncapg + MO4-tp53 standard conditions Fig. 4 with image from Seipold et al., 2009
OTHER MO1-ncapg MORPHOLINO PAGESNo links to external sites
CITATIONS (1)