header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090820-3
Morpholino Name: MO1-ncapg
Target: ncapg (1)
Sequence:
5' - CAGATCCGCGTCTCCAGGCATGATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 4 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ncapg No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ncapg No data available
PHENOTYPE
Phenotype resulting from MO1-ncapg
Phenotype of all Fish created by or utilizing MO1-ncapg
OTHER MO1-ncapg MORPHOLINO PAGES No links to external sites
CITATIONS (1)