Morpholino

MO2-spi1a

ID

ZDB-MRPHLNO-090814-2

Name

MO2-spi1a

Previous Names

Target

Sequence

5' - AGCGACTCACGCTGTGGAGGAACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-spi1a

Expressed Gene	Anatomy	Figures
gata1a	intermediate cell mass of mesoderm	Fig. 3 from Bukrinsky et al., 2009
lcp1	(not) intermediate cell mass of mesoderm macrophage yolk macrophage	Fig. 3 from Bukrinsky et al., 2009
mpx	intermediate cell mass of mesoderm granulocyte yolk granulocyte	Fig. 3 from Bukrinsky et al., 2009
spi1a	(not) anterior lateral plate mesoderm (not) intermediate cell mass of mesoderm	Fig. 4 from Bukrinsky et al., 2009
spi1b	anterior lateral plate mesoderm intermediate cell mass of mesoderm	Fig. 4 from Bukrinsky et al., 2009

Phenotype

Phenotype resulting from MO2-spi1a

Phenotype	Fish	Figures
blood island lacks parts or has fewer parts of type granulocyte, abnormal	WT + MO2-spi1a	Fig. 3 from Bukrinsky et al., 2009
blood island lacks parts or has fewer parts of type macrophage, abnormal	WT + MO2-spi1a	Fig. 3 from Bukrinsky et al., 2009
regulation of myeloid leukocyte differentiation disrupted, abnormal	WT + MO2-spi1a	Fig. 3, Fig. 4 from Bukrinsky et al., 2009
yolk lacks parts or has fewer parts of type granulocyte, abnormal	WT + MO2-spi1a	Fig. 3 from Bukrinsky et al., 2009
yolk lacks parts or has fewer parts of type macrophage, abnormal	WT + MO2-spi1a	Fig. 3 from Bukrinsky et al., 2009

Phenotype of all Fish created by or utilizing MO2-spi1a

Phenotype	Fish	Conditions	Figures
blood island lacks parts or has fewer parts of type macrophage, abnormal	WT + MO2-spi1a	standard conditions	Fig. 3 from Bukrinsky et al., 2009
regulation of myeloid leukocyte differentiation disrupted, abnormal	WT + MO2-spi1a	standard conditions	Fig. 3, Fig. 4 from Bukrinsky et al., 2009
blood island lacks parts or has fewer parts of type granulocyte, abnormal	WT + MO2-spi1a	standard conditions	Fig. 3 from Bukrinsky et al., 2009
yolk lacks parts or has fewer parts of type macrophage, abnormal	WT + MO2-spi1a	standard conditions	Fig. 3 from Bukrinsky et al., 2009
yolk lacks parts or has fewer parts of type granulocyte, abnormal	WT + MO2-spi1a	standard conditions	Fig. 3 from Bukrinsky et al., 2009
whole organism runx1 expression decreased amount, abnormal	WT + MO1-spi1b + MO2-spi1a	standard conditions	Fig. 5 from Frame et al., 2020
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	WT + MO1-spi1b + MO2-spi1a	standard conditions	Fig. 5 from Frame et al., 2020
caudal hematopoietic tissue hematopoietic multipotent progenitor cell decreased amount, abnormal	WT + MO1-spi1b + MO2-spi1a	chemical treatment by environment: nigericin	Fig. 5 from Frame et al., 2020

Citations