Morpholino
MO4-znf703
- ID
- ZDB-MRPHLNO-090724-2
- Name
- MO4-znf703
- Previous Names
-
- nlz1 MO (1)
- Target
- Sequence
-
5' - AGAAGTCGTACCTCAATGCTCACGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-znf703
Expressed Gene | Anatomy | Figures |
---|---|---|
eya2 |
Fig. 6 ![]() |
|
lmx1bb |
Fig. 6 ![]() |
1 - 2 of 2
Phenotype
Phenotype resulting from MO4-znf703
No data available
Phenotype of all Fish created by or utilizing MO4-znf703
1 - 5 of 20 Show all
Citations
- Labalette, C., Wassef, M.A., Desmarquet-Trin Dinh, C., Bouchoucha, Y.X., Le Men, J., Charnay, P., Gilardi-Hebenstreit, P. (2015) Molecular dissection of segment formation in the developing hindbrain. Development (Cambridge, England). 142:185-95
- Bouchoucha, Y.X., Reingruber, J., Labalette, C., Wassef, M.A., Thierion, E., Desmarquet-Trin Dinh, C., Holcman, D., Gilardi-Hebenstreit, P., and Charnay, P. (2013) Dissection of a Krox20 positive feedback loop driving cell fate choices in hindbrain patterning. Molecular Systems Biology. 9:690
- Lupo, G., Gestri, G., O'Brien, M., Denton, R.M., Chandraratna, R.A., Ley, S.V., Harris, W.A., and Wilson, S.W. (2011) Retinoic acid receptor signaling regulates choroid fissure closure through independent mechanisms in the ventral optic cup and periocular mesenchyme. Proceedings of the National Academy of Sciences of the United States of America. 108(21):8698-8703
- Nakamura, M., Choe, S.K., Runko, A.P., Gardner, P.D., and Sagerström, C.G. (2008) Nlz1/Znf703 acts as a repressor of transcription. BMC Developmental Biology. 8:108
- Hoyle, J., Tang, Y.P., Wiellette, E.L., Wardle, F.C., and Sive, H. (2004) nlz Gene family is required for hindbrain patterning in the zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 229(4):835-846
1 - 5 of 5
Show