Morpholino

MO1-upf3a

ID
ZDB-MRPHLNO-090715-2
Name
MO1-upf3a
Previous Names
  • Upf3a StartSite (1)
Target
Sequence
5' - TCTGCTCCTTTTCAGACCTCATATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-upf3a
No data available
Phenotype
Phenotype resulting from MO1-upf3a
Phenotype of all Fish created by or utilizing MO1-upf3a
Phenotype Fish Conditions Figures
brain morphogenesis process quality, abnormal TU + MO1-upf3a standard conditions Fig. 3 from Wittkopp et al., 2009
ventral mandibular arch malformed, abnormal amer1zf4147/zf4147 + MO1-upf3a (TU) control Figure 5 with image from Sun et al., 2024
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal foxm1x67/x67 + MO1-upf3a standard conditions Fig. 5 from Ali et al., 2025
whole organism decreased length, abnormal nid1azju125/zju125 + MO1-upf3a (TU) standard conditions Fig. S5 from Ma et al., 2019
whole organism decreased length, exacerbated nid1azju125/zju125 + MO1-upf3a (TU) standard conditions Fig. S5 from Ma et al., 2019
whole organism aplp1 expression increased amount, abnormal AB + MO1-upf3a + MO3-upf3b standard conditions Figure 7. with image from Rahmati et al., 2024
midbrain hindbrain boundary decreased size, abnormal TU + MO1-upf3a + MO1-upf3b standard conditions Fig. 3 from Wittkopp et al., 2009
hindbrain elongated, abnormal TU + MO1-upf3a + MO1-upf3b standard conditions Fig. 3 from Wittkopp et al., 2009
central nervous system necrotic, abnormal TU + MO1-upf3a + MO1-upf3b standard conditions Fig. 3 from Wittkopp et al., 2009
brain morphogenesis disrupted, abnormal TU + MO1-upf3a + MO1-upf3b standard conditions Fig. 3 from Wittkopp et al., 2009
cranial cartilage joint morphology, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 3-7 absent, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 1 hypoplastic, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 2 hypoplastic, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
whole organism aplp2 expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appa expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism appb expression decreased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
whole organism aplp1 expression increased amount, abnormal appbzf3355/zf3355 + MO1-upf3a + MO3-upf3b (AB) standard conditions Figure 7. with image from Rahmati et al., 2024
cranial cartilage chondrocyte disorganized, abnormal amer1zf4147/zf4147; ba2Tg + MO1-upf3a (TU) control Figure 5 with image from Sun et al., 2024
cranial cartilage chondrocyte swollen, abnormal amer1zf4147/zf4147; ba2Tg + MO1-upf3a (TU) control Figure 5 with image from Sun et al., 2024
Citations