Morpholino
MO1-upf3a
- ID
- ZDB-MRPHLNO-090715-2
- Name
- MO1-upf3a
- Previous Names
-
- Upf3a StartSite (1)
- Target
- Sequence
-
5' - TCTGCTCCTTTTCAGACCTCATATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-upf3a
No data available
Phenotype
Phenotype resulting from MO1-upf3a
| Phenotype | Fish | Figures |
|---|---|---|
| brain morphogenesis process quality, abnormal | TU + MO1-upf3a |
Fig. 3
from Wittkopp et al., 2009 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-upf3a
1 - 5 of 11 Show all
Citations
- Rahmati, M., Chebli, J., Banote, R.K., Roselli, S., Agholme, L., Zetterberg, H., Abramsson, A. (2024) Fine-tuning amyloid precursor protein expression through non-sense mediated mRNA decay. eNeuro. 11(6):
- Xie, A., Ma, Z., Wang, J., Zhang, Y., Chen, Y., Yang, C., Chen, J., Peng, J. (2023) Upf3a but not Upf1 mediates the genetic compensation response induced by leg1 deleterious mutations in an H3K4me3-independent manner. Cell discovery. 9:6363
- Wang, Y., Ping, L., Luan, X., Chen, Y., Fan, X., Li, L., Liu, Y., Wang, P., Zhang, S., Zhang, B., Chen, X. (2020) A Mutation in VWA1, Encoding von Willebrand Factor A Domain-Containing Protein 1, Is Associated With Hemifacial Microsomia. Frontiers in cell and developmental biology. 8:571004
- Ma, Z., Zhu, P., Shi, H., Guo, L., Zhang, Q., Chen, Y., Chen, S., Zhang, Z., Peng, J., Chen, J. (2019) PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature. 568(7751):259-263
- Wittkopp, N., Huntzinger, E., Weiler, C., Saulière, J., Schmidt, S., Sonawane, M., and Izaurralde, E. (2009) Nonsense-mediated mRNA decay effectors are essential for zebrafish embryonic development and survival. Molecular and cellular biology. 29(13):3517-3528
1 - 5 of 5
Show