Morpholino

MO2-yap1

ID
ZDB-MRPHLNO-090624-1
Name
MO2-yap1
Previous Names
  • yap-MO (1)
Target
Sequence
5' - CTCTTCTTTCTATCCAACAGAAACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5' untranslated region.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-yap1
No data available
Phenotype
Phenotype resulting from MO2-yap1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
brain apoptotic, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
brain hydrocephalic, abnormal WT + MO2-yap1 Fig. 2 from He et al., 2015
brain morphology, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
brain development disrupted, abnormal AB + MO2-yap1 Fig. 2Fig. 3 from Jiang et al., 2009
cartilage development disrupted, abnormal AB + MO2-yap1 Fig. 4 from Jiang et al., 2009
caudal fin aplastic, abnormal AB + MO2-yap1 Fig. 2 from Jiang et al., 2009
caudal fin curved, abnormal WT + MO2-yap1 Fig. 2 from He et al., 2015
caudal fin decreased length, abnormal WT + MO2-yap1 Fig. 2 from He et al., 2015
caudal fin apoptotic process increased process quality, abnormal WT + MO2-yap1 Fig. 4 from Hu et al., 2013
ceratobranchial cartilage morphology, abnormal AB + MO2-yap1 Fig. 4 from Jiang et al., 2009
ceratohyal cartilage mislocalised posteriorly, abnormal AB + MO2-yap1 Fig. 4 from Jiang et al., 2009
cloaca atretic, abnormal WT + MO2-yap1 Fig. 2 from He et al., 2015
cloaca disorganized, abnormal zf34Tg + MO2-yap1 Fig. 3 from He et al., 2015
cloaca morphology, abnormal zf34Tg + MO2-yap1 Fig. 2Fig. 3 from He et al., 2015
cranial neural crest cell mislocalised, abnormal AB + MO2-yap1 Fig. 4 from Jiang et al., 2009
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO2-yap1 Figure 1 with image from Fillatre et al., 2019
embryo development delayed, abnormal WT + MO2-yap1 Fig. 2Fig. 5 from Hu et al., 2013
embryonic camera-type eye development disrupted, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
embryonic cranial skeleton morphogenesis disrupted, abnormal AB + MO2-yap1 Fig. 2 from Jiang et al., 2009
eye decreased size, abnormal WT + MO2-yap1 Fig. 2Fig. 5 from He et al., 2015
Fig. 2 from Jiang et al., 2009
head decreased size, abnormal AB + MO2-yap1 Fig. 2 from Jiang et al., 2009
head apoptotic process increased process quality, abnormal WT + MO2-yap1 Fig. 4 from Hu et al., 2013
heart formation delayed, abnormal WT + MO2-yap1 Fig. 7 from Hu et al., 2013
heart jogging process quality, abnormal AB/TU + MO2-yap1 Figure 1 with image from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO2-yap1 Figure 1 with image from Fillatre et al., 2019
hemopoiesis delayed, abnormal rj6Tg + MO2-yap1 Fig. 8 from Hu et al., 2013
lens morphology, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
Meckel's cartilage decreased length, abnormal AB + MO2-yap1 Fig. 4 from Jiang et al., 2009
multi-ciliated epithelial cell cilium disorganized, abnormal WT + MO2-yap1 Fig. 5 from He et al., 2015
neurogenesis disrupted, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
optic vesicle apoptotic, abnormal AB + MO2-yap1 Fig. 3 from Jiang et al., 2009
pericardium edematous, abnormal WT + MO2-yap1 Fig. 2 from He et al., 2015
Fig. 2 from Jiang et al., 2009
pharyngeal arch 3-7 morphology, abnormal AB + MO2-yap1 Fig. 4 from Jiang et al., 2009
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO2-yap1 Fig. 5 from He et al., 2015
posterior lateral line primordium has fewer parts of type cell, abnormal zf551Tg + MO2-yap1 Fig. 5 with image from Wang et al., 2018
posterior pronephric duct morphology, abnormal zf34Tg + MO2-yap1 Fig. 3 from He et al., 2015
pronephric duct broken, abnormal zf34Tg + MO2-yap1 Fig. 3 from He et al., 2015
pronephric duct cilium decreased length, abnormal WT + MO2-yap1 Fig. 5 from He et al., 2015
pronephric duct establishment or maintenance of cell polarity decreased process quality, abnormal WT + MO2-yap1 Fig. 4 from He et al., 2015
pronephric duct multi-ciliated epithelial cell disorganized, abnormal WT + MO2-yap1 Fig. 5Fig. 6 from He et al., 2015
pronephric duct single ciliated epithelial cell decreased amount, abnormal WT + MO2-yap1 Fig. 5 from He et al., 2015
pronephric duct morphogenesis process quality, abnormal zf34Tg + MO2-yap1 Fig. 3 from He et al., 2015
pronephric proximal convoluted tubule morphology, abnormal WT + MO2-yap1 Fig. S2 from He et al., 2015
pronephric tubule increased diameter, abnormal WT + MO2-yap1 Fig. 4Fig. S2 from He et al., 2015
pronephric tubule ciliary basal body mislocalised, abnormal WT + MO2-yap1 Fig. 6 from He et al., 2015
pronephric tubule distal region dilated, abnormal WT + MO2-yap1 Fig. 3Fig. 4 from He et al., 2015
pronephric tubule proximal region dilated, abnormal WT + MO2-yap1 Fig. 4 from He et al., 2015
pronephros cystic, abnormal zf34Tg + MO2-yap1 Fig. 2Fig. 3 from He et al., 2015
somite U-shaped, abnormal WT + MO2-yap1 Fig. 6 from Hu et al., 2013
trunk decreased size, abnormal WT + MO2-yap1 Fig. 1 from Hu et al., 2013
whole organism curved, abnormal WT + MO2-yap1 Fig. 1 from Hu et al., 2013
whole organism has fewer parts of type posterior lateral line neuromast, abnormal zf551Tg + MO2-yap1 Fig. 5 with image from Wang et al., 2018
whole organism morphology, abnormal WT + MO2-yap1 Fig. 1 from Hu et al., 2013
Phenotype of all Fish created by or utilizing MO2-yap1
Phenotype Fish Conditions Figures
caudal fin aplastic, abnormal AB + MO2-yap1 standard conditions Fig. 2 from Jiang et al., 2009
brain morphology, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
brain development disrupted, abnormal AB + MO2-yap1 standard conditions Fig. 2Fig. 3 from Jiang et al., 2009
cranial neural crest cell mislocalised, abnormal AB + MO2-yap1 standard conditions Fig. 4 from Jiang et al., 2009
head decreased size, abnormal AB + MO2-yap1 standard conditions Fig. 2 from Jiang et al., 2009
embryonic camera-type eye development disrupted, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
pericardium edematous, abnormal AB + MO2-yap1 standard conditions Fig. 2 from Jiang et al., 2009
pharyngeal arch 3-7 morphology, abnormal AB + MO2-yap1 standard conditions Fig. 4 from Jiang et al., 2009
Meckel's cartilage decreased length, abnormal AB + MO2-yap1 standard conditions Fig. 4 from Jiang et al., 2009
ceratohyal cartilage mislocalised posteriorly, abnormal AB + MO2-yap1 standard conditions Fig. 4 from Jiang et al., 2009
neurogenesis disrupted, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
cartilage development disrupted, abnormal AB + MO2-yap1 standard conditions Fig. 4 from Jiang et al., 2009
brain apoptotic, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
eye decreased size, abnormal AB + MO2-yap1 standard conditions Fig. 2 from Jiang et al., 2009
embryonic cranial skeleton morphogenesis disrupted, abnormal AB + MO2-yap1 standard conditions Fig. 2 from Jiang et al., 2009
lens morphology, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
apoptotic process increased occurrence, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
ceratobranchial cartilage morphology, abnormal AB + MO2-yap1 standard conditions Fig. 4 from Jiang et al., 2009
optic vesicle apoptotic, abnormal AB + MO2-yap1 standard conditions Fig. 3 from Jiang et al., 2009
heart tube mislocalised, abnormal AB/TU + MO2-yap1 standard conditions Figure 1 with image from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO2-yap1 standard conditions Figure 1 with image from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO2-yap1 standard conditions Figure 1 with image from Fillatre et al., 2019
pronephric duct cilium decreased length, abnormal WT + MO2-yap1 control Fig. 5 from He et al., 2015
pronephric proximal convoluted tubule morphology, abnormal WT + MO2-yap1 control Fig. S2 from He et al., 2015
pronephric duct multi-ciliated epithelial cell disorganized, abnormal WT + MO2-yap1 control Fig. 5Fig. 6 from He et al., 2015
pericardium edematous, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
pronephric tubule distal region dilated, abnormal WT + MO2-yap1 control Fig. 4 from He et al., 2015
head apoptotic process increased process quality, abnormal WT + MO2-yap1 standard conditions Fig. 4 from Hu et al., 2013
cloaca atretic, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
somite U-shaped, abnormal WT + MO2-yap1 standard conditions Fig. 6 from Hu et al., 2013
whole organism curved, abnormal WT + MO2-yap1 standard conditions Fig. 1 from Hu et al., 2013
pronephros cystic, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
embryo development delayed, abnormal WT + MO2-yap1 standard conditions Fig. 2Fig. 5 from Hu et al., 2013
pronephric tubule proximal region dilated, abnormal WT + MO2-yap1 control Fig. 4 from He et al., 2015
photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO2-yap1 control Fig. 5 from He et al., 2015
multi-ciliated epithelial cell cilium disorganized, abnormal WT + MO2-yap1 control Fig. 5 from He et al., 2015
pronephric duct single ciliated epithelial cell decreased amount, abnormal WT + MO2-yap1 control Fig. 5 from He et al., 2015
trunk decreased size, abnormal WT + MO2-yap1 standard conditions Fig. 1 from Hu et al., 2013
pronephric tubule ciliary basal body mislocalised, abnormal WT + MO2-yap1 control Fig. 6 from He et al., 2015
pronephric duct morphogenesis process quality, abnormal WT + MO2-yap1 control Fig. 3 from He et al., 2015
pronephric tubule increased diameter, abnormal WT + MO2-yap1 control Fig. 4Fig. S2 from He et al., 2015
pronephric duct establishment or maintenance of cell polarity decreased process quality, abnormal WT + MO2-yap1 control Fig. 4 from He et al., 2015
eye decreased size, abnormal WT + MO2-yap1 control Fig. 2Fig. 5 from He et al., 2015
whole organism morphology, abnormal WT + MO2-yap1 standard conditions Fig. 1 from Hu et al., 2013
brain hydrocephalic, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
caudal fin curved, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
caudal fin decreased length, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
caudal fin apoptotic process increased process quality, abnormal WT + MO2-yap1 standard conditions Fig. 4 from Hu et al., 2013
cloaca morphology, abnormal WT + MO2-yap1 control Fig. 2 from He et al., 2015
heart formation delayed, abnormal WT + MO2-yap1 standard conditions Fig. 7 from Hu et al., 2013
hemopoiesis delayed, abnormal rj6Tg + MO2-yap1 standard conditions Fig. 8 from Hu et al., 2013
pronephric duct broken, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
pronephric duct morphogenesis process quality, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
pronephric tubule distal region dilated, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
pronephros cystic, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
posterior pronephric duct morphology, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
cloaca disorganized, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
cloaca morphology, abnormal zf34Tg + MO2-yap1 control Fig. 3 from He et al., 2015
posterior lateral line primordium has fewer parts of type cell, abnormal zf551Tg + MO2-yap1 standard conditions Fig. 5 with image from Wang et al., 2018
whole organism has fewer parts of type posterior lateral line neuromast, abnormal zf551Tg + MO2-yap1 standard conditions Fig. 5 with image from Wang et al., 2018
pronephric duct cystic, exacerbated TU + MO2-yap1 + MO3-pkd2 standard conditions Fig. 7 from Xu et al., 2018
pericardium edematous, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
pronephros cystic, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
pericardium edematous, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
pronephros cystic, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-ift20 + MO2-yap1 control Fig. 7 from He et al., 2015
pericardium edematous, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
pronephros cystic, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
Citations