header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090528-2
Morpholino Name: MO2-pld1a
Target: pld1a (1)
Previous Name: MO2-pld1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTCTCATCACCTCTTAAGAAAGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the intron-exon junction of the exon coding the first HKD motif.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pld1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pld1a
Expressed Gene Anatomy Figures
gata1a Fig. S6 with image from Zeng et al., 2009
pld1a Fig. 3 with image from Zeng et al., 2009
PHENOTYPE
Phenotype resulting from MO2-pld1a
Phenotype of all Fish created by or utilizing MO2-pld1a
Phenotype Fish Conditions Figures
angiogenesis disrupted, abnormal WT + MO1-pld1a + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal WT + MO1-pld1a + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel irregular spatial pattern, abnormal WT + MO1-pld1a + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel irregular spatial pattern, abnormal WT + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
angiogenesis disrupted, abnormal WT + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
erythrocyte differentiation disrupted, abnormal WT + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal WT + MO2-pld1a standard conditions Fig. 4 with image from Zeng et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO2-pld1a standard conditions Fig. 7 with image from Zeng et al., 2009
primary motor neuron branched, abnormal y1Tg + MO2-pld1a standard conditions Fig. 7 with image from Zeng et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO2-pld1a standard conditions Fig. 7 with image from Zeng et al., 2009
vasculogenesis disrupted, abnormal zn1Tg + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
cerebellar central artery disorganized, abnormal zn1Tg + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
inner optic circle decreased amount, abnormal zn1Tg + MO2-pld1a standard conditions Fig. S6 with image from Zeng et al., 2009
OTHER MO2-pld1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)