ZFIN ID: ZDB-MRPHLNO-090521-2
Morpholino Name: MO1-sh3gl3b
Target: sh3gl3b (1)
Previous Name: MO1-sh3gl3

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTAAACCCGGCCACTGACATCCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sh3gl3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sh3gl3b
Expressed Gene Anatomy Figures
efnb2a Fig. 1 from Zhao et al., 2013
flt4 Fig. 1 from Zhao et al., 2013
PHENOTYPE
Phenotype resulting from MO1-sh3gl3b
Phenotype of all Fish created by or utilizing MO1-sh3gl3b
Phenotype Fish Conditions Figures
blood circulation absent, abnormal AB + MO1-sh3gl3b standard conditions Fig. 1 from Zhao et al., 2013
blood cell accumulation sinus venosus, abnormal AB + MO1-sh3gl3b standard conditions Fig. 1 from Zhao et al., 2013
blood decreased fluid flow, abnormal zn1Tg + MO1-sh3gl3b standard conditions Fig. 6 with image from Gomez et al., 2009
dorsal aorta decreased diameter, abnormal zn1Tg + MO1-sh3gl3b chemical treatment: wortmannin Fig. S8 from Zhao et al., 2013
dorsal aorta decreased diameter, abnormal zn1Tg + MO1-sh3gl3b chemical treatment: tyrphostin AG 1478 Fig. 4 from Zhao et al., 2013
posterior cardinal vein increased diameter, abnormal zn1Tg + MO1-sh3gl3b standard conditions Fig. 6 with image from Gomez et al., 2009
dorsal aorta decreased diameter, abnormal zn1Tg + MO1-sh3gl3b chemical treatment: LY294002 Fig. 3 from Zhao et al., 2013
dorsal aorta blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-sh3gl3b chemical treatment: wortmannin Fig. S8 from Zhao et al., 2013
blood circulation disrupted, abnormal zn1Tg + MO1-sh3gl3b standard conditions Fig. 6 with image from Gomez et al., 2009
dorsal aorta blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-sh3gl3b chemical treatment: LY294002 Fig. 3 from Zhao et al., 2013
dorsal aorta decreased diameter, abnormal zn1Tg + MO1-sh3gl3b standard conditions Fig. 1Fig. 3 from Zhao et al., 2013
Fig. 6 with image from Gomez et al., 2009
dorsal aorta blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-sh3gl3b standard conditions Fig. 1Fig. 3 from Zhao et al., 2013
dorsal aorta blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-sh3gl3b chemical treatment: tyrphostin AG 1478 Fig. 4 from Zhao et al., 2013
dorsal aorta decreased diameter, abnormal zn1Tg + MO1-egfra + MO1-sh3gl3b standard conditions Fig. S9 from Zhao et al., 2013
dorsal aorta blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-egfra + MO1-sh3gl3b standard conditions Fig. S9 from Zhao et al., 2013
dorsal aorta decreased diameter, abnormal zn1Tg + MO1-sh3gl3b + MO1-sh3kbp1 standard conditions Fig. 2 from Zhao et al., 2013
dorsal aorta blood vessel lumenization decreased process quality, abnormal zn1Tg + MO1-sh3gl3b + MO1-sh3kbp1 standard conditions Fig. 2 from Zhao et al., 2013
Genome Resources:
CITATIONS (2)