Morpholino

MO1-cep70

ID
ZDB-MRPHLNO-090508-2
Name
MO1-cep70
Previous Names
  • MOzcep70st (1)
Target
Sequence
5' - TTCTCTCTGTTCTTCCTGCTCCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep70
Expressed Gene Anatomy Figures
ctslb Fig. 6 with image from Wilkinson et al., 2009
dlx3b Fig. 6 with image from Wilkinson et al., 2009
foxa3 Fig. 5 with image from Wilkinson et al., 2009
otx5 Fig. 5 with image from Wilkinson et al., 2009
Phenotype
Phenotype resulting from MO1-cep70
Phenotype Fish Figures
central canal cilium decreased length, abnormal WT + MO1-cep70 Fig. 4 with image from Wilkinson et al., 2009
determination of left/right symmetry disrupted, abnormal WT + MO1-cep70 Fig. 5 with image from Wilkinson et al., 2009
liver inverted, abnormal WT + MO1-cep70 Fig. 5 with image from Wilkinson et al., 2009
otolith mislocalised, abnormal WT + MO1-cep70 Fig. 1 with image from Wilkinson et al., 2009
otolith organ has extra parts of type otolith, abnormal WT + MO1-cep70 Fig. 1 with image from Wilkinson et al., 2009
parapineal organ inverted, abnormal WT + MO1-cep70 Fig. 5 with image from Wilkinson et al., 2009
pronephric duct increased size, abnormal WT + MO1-cep70 Fig. 4 with image from Wilkinson et al., 2009
pronephric duct cilium decreased length, abnormal WT + MO1-cep70 Fig. 4 with image from Wilkinson et al., 2009
whole organism curved ventral, abnormal WT + MO1-cep70 Fig. 1 with image from Wilkinson et al., 2009
whole organism decreased length, abnormal WT + MO1-cep70 Fig. 1 with image from Wilkinson et al., 2009
yolk protruding, abnormal WT + MO1-cep70 Fig. 6 with image from Wilkinson et al., 2009
Phenotype of all Fish created by or utilizing MO1-cep70
Phenotype Fish Conditions Figures
pronephric duct cilium decreased length, abnormal WT + MO1-cep70 standard conditions Fig. 4 with image from Wilkinson et al., 2009
pronephric duct increased size, abnormal WT + MO1-cep70 standard conditions Fig. 4 with image from Wilkinson et al., 2009
otolith mislocalised, abnormal WT + MO1-cep70 standard conditions Fig. 1 with image from Wilkinson et al., 2009
otolith organ has extra parts of type otolith, abnormal WT + MO1-cep70 standard conditions Fig. 1 with image from Wilkinson et al., 2009
central canal cilium decreased length, abnormal WT + MO1-cep70 standard conditions Fig. 4 with image from Wilkinson et al., 2009
determination of left/right symmetry disrupted, abnormal WT + MO1-cep70 standard conditions Fig. 5 with image from Wilkinson et al., 2009
parapineal organ inverted, abnormal WT + MO1-cep70 standard conditions Fig. 5 with image from Wilkinson et al., 2009
yolk protruding, abnormal WT + MO1-cep70 standard conditions Fig. 6 with image from Wilkinson et al., 2009
liver inverted, abnormal WT + MO1-cep70 standard conditions Fig. 5 with image from Wilkinson et al., 2009
whole organism curved ventral, abnormal WT + MO1-cep70 standard conditions Fig. 1 with image from Wilkinson et al., 2009
whole organism decreased length, abnormal WT + MO1-cep70 standard conditions Fig. 1 with image from Wilkinson et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.