Morpholino

MO2-nr4a2a,nr4a2b

ID

ZDB-MRPHLNO-090209-1

Name

MO2-nr4a2a,nr4a2b

Previous Names

MO2-nr4a2a+nr4a2b
nr4a2mo (1)

Targets

nr4a2a (1)
nr4a2b (1)

Sequence

5' - CATACTGAGCCTGGACGCAGGGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-nr4a2a,nr4a2b

Expressed Gene	Anatomy	Figures
nr4a1	midbrain hindbrain boundary pretectum ventral telencephalon	Fig. SD8 from Blin et al., 2008
nr4a2a	whole organism	Fig. S3 from Luo et al., 2008
nr4a2b	(not) caudal tuberculum dorsal thalamus floor plate rhombomere 1 forebrain (not) preoptic area pretectum telencephalon (not) ventral thalamus whole organism	Fig. SD8 from Blin et al., 2008 Fig. 5 , Fig. S3 from Luo et al., 2008
nr4a3	habenula medulla oblongata pretectum rhombomere 1 ventral telencephalon ventral thalamus	Fig. SD8 from Blin et al., 2008
slc6a3	caudal tuberculum	Fig. 4 from Luo et al., 2008
th	caudal tuberculum diencephalon forebrain hypothalamus locus coeruleus olfactory bulb periventricular nucleus of caudal tuberculum dopaminergic neuron preoptic area pretectum ventral thalamus dopaminergic neuron	Fig. 8 from Chen et al., 2012 Fig. 4 , Fig. SD10 from Blin et al., 2008 Fig. 4 , Fig. 5 from Luo et al., 2008

Phenotype

Phenotype resulting from MO2-nr4a2a,nr4a2b

No data available

Phenotype of all Fish created by or utilizing MO2-nr4a2a,nr4a2b

Phenotype	Fish	Conditions	Figures
forebrain neuron development disrupted, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 4 , Fig. 5 from Luo et al., 2008
forebrain adrenergic neuron decreased amount, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 5 from Luo et al., 2008
brain neuron apoptotic, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 7 from Blin et al., 2008
preoptic area adrenergic neuron decreased amount, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 4 from Luo et al., 2008
periventricular nucleus of caudal tuberculum has fewer parts of type dopaminergic neuron, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 8 from Chen et al., 2012
caudal tuberculum adrenergic neuron decreased amount, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 4 from Luo et al., 2008
pretectum adrenergic neuron decreased amount, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 4 from Luo et al., 2008
whole organism increased behavioural activity, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 8 from Blin et al., 2008
ventral thalamus has fewer parts of type dopaminergic neuron, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 8 from Chen et al., 2012
locomotion involved in locomotory behavior increased occurrence, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 8 from Blin et al., 2008
olfactory bulb adrenergic neuron decreased amount, abnormal	WT + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 4 from Luo et al., 2008
neutrophil decreased amount, abnormal	i114Tg + MO2-nr4a2a,nr4a2b	standard conditions	Fig. 7 from Prince et al., 2017

Citations