Morpholino

MO2-tbxtb

ID

ZDB-MRPHLNO-090206-2

Name

MO2-tbxtb

Previous Names

MO2-tb

Target

tbxtb (1)

Sequence

5' - GACAGTCACCGGAGTCCATTCTATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a translation blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tbxtb

Expressed Gene	Anatomy	Figures
etv4	axial mesoderm margin	Fig. 5 from Martin et al., 2008
fgf8a	axial mesoderm paraxial mesoderm	Fig. 5 from Martin et al., 2008
myod1	somite	Fig. 2 from Martin et al., 2008
tbx16l	paraxial mesoderm	Fig. 2 from Martin et al., 2008
tbxta	margin notochord	Fig. 2 from Martin et al., 2008
wnt3a	paraxial mesoderm	Fig. 6 from Martin et al., 2008
wnt8a	margin mesoderm	Fig. 6 from Martin et al., 2008

Phenotype

Phenotype resulting from MO2-tbxtb

No data available

Phenotype of all Fish created by or utilizing MO2-tbxtb

Phenotype	Fish	Conditions	Figures
somite decreased amount, abnormal	tbxta^b195/b195 + MO2-tbxtb	standard conditions	Fig. 2 from Martin et al., 2008
somite decreased size, abnormal	tbxta^b195/b195 + MO2-tbxtb	standard conditions	Fig. 2 from Martin et al., 2008
post-vent region decreased length, abnormal	tbxta^b195/b195 + MO2-tbxtb	standard conditions	Fig. 2 from Martin et al., 2008
somite morphology, abnormal	tbxta^b195/b195 + MO2-tbxtb	standard conditions	Fig. 2 from Martin et al., 2008
caudal fin kinked, abnormal	tbxta^w181/w181 + MO2-tbxtb + MO4-tp53	cold exposure	Fig. 5 from Kimelman, 2016
caudal fin morphology, abnormal	tbxta^w181/w181 + MO2-tbxtb + MO4-tp53	cold exposure	Fig. 5 from Kimelman, 2016
caudal fin truncated, abnormal	tbxta^w181/w181 + MO2-tbxtb + MO4-tp53	cold exposure	Fig. 5 from Kimelman, 2016
determination of pancreatic left/right asymmetry decreased occurrence, abnormal	AB + MO2-tbxta + MO2-tbxtb + MO4-tp53	standard conditions	Fig. S3 from Nelson et al., 2017
digestive tract development process quality, abnormal	AB + MO2-tbxta + MO2-tbxtb + MO4-tp53	standard conditions	Fig. S3 from Nelson et al., 2017
pancreas development process quality, abnormal	AB + MO2-tbxta + MO2-tbxtb + MO4-tp53	standard conditions	Fig. S3 from Nelson et al., 2017
liver development process quality, abnormal	AB + MO2-tbxta + MO2-tbxtb + MO4-tp53	standard conditions	Fig. S3 from Nelson et al., 2017
determination of digestive tract left/right asymmetry decreased occurrence, abnormal	AB + MO2-tbxta + MO2-tbxtb + MO4-tp53	standard conditions	Fig. S3 from Nelson et al., 2017
determination of liver left/right asymmetry decreased occurrence, abnormal	AB + MO2-tbxta + MO2-tbxtb + MO4-tp53	standard conditions	Fig. S3 from Nelson et al., 2017

Citations