Morpholino

MO1-ak2

ID

ZDB-MRPHLNO-090108-2

Name

MO1-ak2

Previous Names

None

Target

ak2 (1)

Sequence

5' - CATCCAGCTACAAATGAGAAACAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ak2

No data available

Phenotype

Phenotype resulting from MO1-ak2

Phenotype	Fish	Figures
blood island apoptotic process increased process quality, abnormal	EKW + MO1-ak2	Fig. 5 from Rissone et al., 2015
granulocyte decreased amount, abnormal	EKW + MO1-ak2	Fig. 3 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal	la2Tg + MO1-ak2	Fig. 4 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal	EKW + MO1-ak2	Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal	EKW + MO1-ak2	Fig. 5 from Rissone et al., 2015
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal	EKW + MO1-ak2	Fig. 5 from Rissone et al., 2015
leukocyte differentiation disrupted, abnormal	WT + MO1-ak2	Fig. 3, Fig. S4 from Pannicke et al., 2009

Phenotype of all Fish created by or utilizing MO1-ak2

Phenotype	Fish	Conditions	Figures
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal	EKW + MO1-ak2	control	Fig. 5 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal	EKW + MO1-ak2	control	Fig. 4 from Rissone et al., 2015
blood island apoptotic process increased process quality, abnormal	EKW + MO1-ak2	control	Fig. 5 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal	EKW + MO1-ak2	control	Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal	EKW + MO1-ak2	control	Fig. 5 from Rissone et al., 2015
granulocyte decreased amount, abnormal	EKW + MO1-ak2	control	Fig. 3 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal	EKW + MO1-ak2 + MO2-ak2	control	Fig. 4 from Rissone et al., 2015
granulocyte decreased amount, abnormal	EKW + MO1-ak2 + MO2-ak2	control	Fig. 3 from Rissone et al., 2015
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal	EKW + MO1-ak2 + MO2-ak2	control	Fig. 5 from Rissone et al., 2015
blood island apoptotic process increased process quality, abnormal	EKW + MO1-ak2 + MO2-ak2	control	Fig. 5 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal	EKW + MO1-ak2 + MO2-ak2	control	Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal	EKW + MO1-ak2 + MO2-ak2	control	Fig. 5 from Rissone et al., 2015
leukocyte differentiation disrupted, abnormal	WT + MO1-ak2	standard conditions	Fig. 3, Fig. S4 from Pannicke et al., 2009
hematopoietic stem cell differentiation decreased process quality, abnormal	la2Tg + MO1-ak2	control	Fig. 4 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal	la2Tg + MO1-ak2	control	Fig. 4 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal	la2Tg + MO1-ak2 + MO2-ak2	control	Fig. 4 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal	la2Tg + MO1-ak2 + MO2-ak2	control	Fig. 4 from Rissone et al., 2015

Citations