Morpholino

MO2-meis1b

ID
ZDB-MRPHLNO-090107-1
Name
MO2-meis1b
Previous Names
None
Target
Sequence
5' - TATATCTTCGTACCTCTGCGCCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-meis1b
No data available
Phenotype
Phenotype resulting from MO2-meis1b
Phenotype Fish Figures
angiogenesis disrupted, abnormal WT + MO2-meis1b Fig. 2 from Minehata et al., 2008
artery morphogenesis disrupted, abnormal WT + MO2-meis1b Fig. 2 from Minehata et al., 2008
blood circulation disrupted, abnormal WT + MO2-meis1b Fig. 1 from Minehata et al., 2008
blood vessel morphogenesis disrupted, abnormal WT + MO2-meis1b Fig. 3 from Minehata et al., 2008
ceratobranchial cartilage fused with ceratobranchial cartilage, abnormal WT + MO2-meis1b Fig. 3 with image from Melvin et al., 2013
ceratohyal cartilage fused with ceratobranchial cartilage, abnormal WT + MO2-meis1b Fig. 3 with imageFig. S3 with image from Melvin et al., 2013
cranial cartilage mislocalised, abnormal WT + MO2-meis1b Fig. 3 with image from Melvin et al., 2013
dorsal aorta morphology, abnormal WT + MO2-meis1b Fig. 2 from Minehata et al., 2008
eye decreased size, abnormal WT + MO2-meis1b Fig. 1 from Minehata et al., 2008
heart inverted, abnormal WT + MO2-meis1b Fig. 1 from Minehata et al., 2008
heart contraction disrupted, abnormal WT + MO2-meis1b Fig. 1 from Minehata et al., 2008
heart looping disrupted, abnormal WT + MO2-meis1b Fig. 1 from Minehata et al., 2008
intersegmental vessel morphology, abnormal WT + MO2-meis1b Fig. 2 from Minehata et al., 2008
Meckel's cartilage fused with hyosymplectic cartilage, abnormal WT + MO2-meis1b Fig. 3 with imageFig. S3 with image from Melvin et al., 2013
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO2-meis1b Fig. 3 with image from Melvin et al., 2013
palatoquadrate cartilage flattened, abnormal WT + MO2-meis1b Fig. 3 with imageFig. S3 with image from Melvin et al., 2013
pericardium edematous, abnormal WT + MO2-meis1b Fig. 1 from Minehata et al., 2008
vasculogenesis disrupted, abnormal WT + MO2-meis1b Fig. 2 from Minehata et al., 2008
Phenotype of all Fish created by or utilizing MO2-meis1b
Phenotype Fish Conditions Figures
intersegmental vessel morphology, abnormal WT + MO2-meis1b standard conditions Fig. 2 from Minehata et al., 2008
ceratohyal cartilage fused with ceratobranchial cartilage, abnormal WT + MO2-meis1b standard conditions Fig. 3 with imageFig. S3 with image from Melvin et al., 2013
ceratobranchial cartilage fused with ceratobranchial cartilage, abnormal WT + MO2-meis1b standard conditions Fig. 3 with image from Melvin et al., 2013
heart looping disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 1 from Minehata et al., 2008
eye decreased size, abnormal WT + MO2-meis1b standard conditions Fig. 1 from Minehata et al., 2008
heart contraction disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 1 from Minehata et al., 2008
pericardium edematous, abnormal WT + MO2-meis1b standard conditions Fig. 1 from Minehata et al., 2008
angiogenesis disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 2 from Minehata et al., 2008
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO2-meis1b standard conditions Fig. 3 with image from Melvin et al., 2013
artery morphogenesis disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 2 from Minehata et al., 2008
vasculogenesis disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 2 from Minehata et al., 2008
dorsal aorta morphology, abnormal WT + MO2-meis1b standard conditions Fig. 2 from Minehata et al., 2008
blood vessel morphogenesis disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 3 from Minehata et al., 2008
palatoquadrate cartilage flattened, abnormal WT + MO2-meis1b standard conditions Fig. 3 with imageFig. S3 with image from Melvin et al., 2013
heart inverted, abnormal WT + MO2-meis1b standard conditions Fig. 1 from Minehata et al., 2008
blood circulation disrupted, abnormal WT + MO2-meis1b standard conditions Fig. 1 from Minehata et al., 2008
Meckel's cartilage fused with hyosymplectic cartilage, abnormal WT + MO2-meis1b standard conditions Fig. 3 with imageFig. S3 with image from Melvin et al., 2013
cranial cartilage mislocalised, abnormal WT + MO2-meis1b standard conditions Fig. 3 with image from Melvin et al., 2013
Meckel's cartilage fused with hyosymplectic cartilage, abnormal WT + MO2-meis1b + MO5-meis1b standard conditions Fig. S3 with image from Melvin et al., 2013
cranial cartilage morphology, abnormal WT + MO2-meis1b + MO5-meis1b standard conditions Fig. S3 with image from Melvin et al., 2013
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO2-meis1b + MO5-meis1b standard conditions Fig. S3 with image from Melvin et al., 2013
palatoquadrate cartilage rotated, abnormal WT + MO2-meis1b + MO5-meis1b standard conditions Fig. S3 with image from Melvin et al., 2013
Citations