ZFIN ID: ZDB-MRPHLNO-081222-1
Morpholino Name: MO1-s1pr1
Target: s1pr1 (1)
Previous Name: edg1-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTAGGTCATCCATGGTTTGCACTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-s1pr1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-s1pr1
Expressed Gene Anatomy Figures
ctslb Fig. 6 with image from Kai et al., 2008
dlx3b Fig. 6 with imageFig. S3 with image from Kai et al., 2008
hlx1 Fig. 6 with image from Kai et al., 2008
nkx2.4b Fig. S3 with image from Kai et al., 2008
pax2a Fig. S3 with image from Kai et al., 2008
tbxta Fig. 6 with image from Kai et al., 2008
PHENOTYPE
Phenotype resulting from MO1-s1pr1
Phenotype of all Fish created by or utilizing MO1-s1pr1
Genome Resources:
CITATIONS (1)