Morpholino
MO2-prickle1a
- ID
- ZDB-MRPHLNO-081220-3
- Name
- MO2-prickle1a
- Previous Names
-
- pk1aMOATG2 (1)
- Target
- Sequence
-
5' - CAGCTCCATCACTAACACCCCCTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prickle1a
No data available
Phenotype
Phenotype resulting from MO2-prickle1a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-prickle1a
1 - 5 of 11 Show all
Citations
- Fuller, T.D., Westfall, T.A., Das, T., Dawson, D.V., Slusarski, D.C. (2018) High-throughput behavioral assay to investigate seizure sensitivity in zebrafish implicates ZFHX3 in epilepsy. Journal of neurogenetics. 32(2):92-105
- Mei, X., Wu, S., Bassuk, A.G., and Slusarski, D.C. (2013) Mechanisms of prickle 1a function in zebrafish epilepsy and retinal neurogenesis. Disease models & mechanisms. 6(3):679-688
- Oteiza, P., Köppen, M., Krieg, M., Pulgar, E., Farias, C., Melo, C., Preibisch, S., Müller, D., Tada, M., Hartel, S., Heisenberg, C.P., and Concha, M.L. (2010) Planar cell polarity signalling regulates cell adhesion properties in progenitors of the zebrafish laterality organ. Development (Cambridge, England). 137(20):3459-3468
- Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H., and Moon, R.T. (2003) Zebrafish prickle, a modulator of noncanonical wnt/fz signaling, regulates gastrulation movements. Current biology : CB. 13(8):680-685
1 - 4 of 4
Show