Morpholino
MO1-pink1
- ID
- ZDB-MRPHLNO-081202-1
- Name
- MO1-pink1
- Previous Names
- None
- Target
- Sequence
-
5' - GCTGAGAACATGCTTTACTGACATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
ATG targeting
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pink1
Expressed Gene | Anatomy | Figures |
---|---|---|
pink1 |
Fig. 2
from Xi et al., 2010 |
|
th |
Fig. 3
from Xi et al., 2010 |
Phenotype
Phenotype resulting from MO1-pink1
Phenotype of all Fish created by or utilizing MO1-pink1
Citations
- O'Donnell, K.C., Vargas, M.E., and Sagasti, A. (2013) WldS and PGC-1alpha Regulate Mitochondrial Transport and Oxidation State after Axonal Injury. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(37):14778-14790
- Xi, Y., Ryan, J., Noble, S., Yu, M., Yilbas, A.E., and Ekker, M. (2010) Impaired dopaminergic neuron development and locomotor function in zebrafish with loss of pink1 function. The European journal of neuroscience. 31(4):623-633
- Anichtchik, O., Diekmann, H., Fleming, A., Roach, A., Goldsmith, P., and Rubinsztein, D.C. (2008) Loss of PINK1 function affects development and results in neurodegeneration in zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 28(33):8199-8207
1 - 3 of 3
Show