Morpholino

MO1-appl1

ID

ZDB-MRPHLNO-081016-2

Name

MO1-appl1

Previous Names

None

Target

Sequence

5' - CAGGTCAAACGCGAACTATGCGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-appl1

Expressed Gene	Anatomy	Figures
appl1	neural keel (not) whole organism	Fig. 3 , Fig. 4 , Fig. 5 from Schenck et al., 2008

Phenotype

Phenotype resulting from MO1-appl1

Phenotype	Fish	Figures
embryo development disrupted, abnormal	WT + MO1-appl1	Fig. 4 from Schenck et al., 2008
extension decreased size, abnormal	WT + MO1-appl1	Fig. 4 from Schenck et al., 2008
forebrain apoptotic, abnormal	WT + MO1-appl1 + MO1-tp53	Fig. 5 , Fig. 7 , Fig. S4 from Schenck et al., 2008
olfactory bulb apoptotic, abnormal	WT + MO1-appl1	Fig. 4 from Schenck et al., 2008
pronephros apoptotic, abnormal	WT + MO1-appl1	Fig. 4 from Schenck et al., 2008
telencephalon apoptotic, abnormal	WT + MO1-appl1	Fig. 4 from Schenck et al., 2008
whole organism apoptotic, abnormal	WT + MO1-appl1	Fig. 4 from Schenck et al., 2008
whole organism bent, abnormal	WT + MO1-appl1	text only from Schenck et al., 2008
whole organism edematous, abnormal	WT + MO1-appl1	text only from Schenck et al., 2008

Phenotype of all Fish created by or utilizing MO1-appl1

Phenotype	Fish	Conditions	Figures
pronephros apoptotic, abnormal	WT + MO1-appl1	standard conditions	Fig. 4 from Schenck et al., 2008
extension decreased size, abnormal	WT + MO1-appl1	standard conditions	Fig. 4 from Schenck et al., 2008
embryo development disrupted, abnormal	WT + MO1-appl1	standard conditions	Fig. 4 from Schenck et al., 2008
olfactory bulb apoptotic, abnormal	WT + MO1-appl1	standard conditions	Fig. 4 from Schenck et al., 2008
whole organism edematous, abnormal	WT + MO1-appl1	standard conditions	text only from Schenck et al., 2008
whole organism bent, abnormal	WT + MO1-appl1	standard conditions	text only from Schenck et al., 2008
telencephalon apoptotic, abnormal	WT + MO1-appl1	standard conditions	Fig. 4 from Schenck et al., 2008
forebrain apoptotic, abnormal	WT + MO1-appl1	standard conditions	Fig. 5 , Fig. 7 , Fig. S4 from Schenck et al., 2008
whole organism apoptotic, abnormal	WT + MO1-appl1	standard conditions	Fig. 4 from Schenck et al., 2008
forebrain apoptotic, abnormal	WT + MO1-appl1 + MO1-tp53	standard conditions	Fig. S4 from Schenck et al., 2008
olfactory system apoptotic, abnormal	WT + MO1-appl1 + MO1-appl2	standard conditions	Fig. S6 from Schenck et al., 2008

Citations