ZFIN ID: ZDB-MRPHLNO-080925-4
Morpholino Name: MO2-pax6b
Target: pax6b (1)
Sequence:
5' - GCCTGAGCCCTTCCGAGCAAAACAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Sequence in publication contained a typo; this represents the corrected sequence.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-pax6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-pax6b
Expressed Gene Anatomy Figures
pax6a Fig. 3 with image from Kleinjan et al., 2008
PHENOTYPE
Phenotype resulting from MO2-pax6b
Phenotype of all Fish created by or utilizing MO2-pax6b
Genome Resources:
CITATIONS (3)