Morpholino

MO3-ttc8

ID

ZDB-MRPHLNO-080918-2

Name

MO3-ttc8

Previous Names

None

Target

ttc8 (1)

Sequence

5' - TCTCACCGGAGAAACACCACACACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-ttc8

Expressed Gene	Anatomy	Figures
crestin	neural crest neuroectoderm	Fig. 2 , Fig. 4 , Fig. 5 , Fig. S7 from Tobin et al., 2008
dct	(not) melanocyte	Fig. 2 from Tobin et al., 2008
foxd3	neural crest	Fig. S7 from Tobin et al., 2008
pax6a	neural tube	Fig. S8 from Tobin et al., 2008
phox2bb	enteric nervous system pharyngeal arch 3-7	Fig. 5 from Tobin et al., 2008
ptch2	notochord	Fig. S8 from Tobin et al., 2008
sox10	neural crest	Fig. S7 from Tobin et al., 2008

Phenotype

Phenotype resulting from MO3-ttc8

Phenotype	Fish	Figures
cilium assembly disrupted, abnormal	TL + MO3-ttc8	Fig. 4 from May-Simera et al., 2010
convergent extension disrupted, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
cranial cartilage aplastic, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
eye decreased distance eye, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
eye decreased size, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
eye fused with eye, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
kidney edematous, abnormal	WT + MO3-ttc8	Fig. 1 from Tobin et al., 2008
Kupffer's vesicle decreased fluid flow, abnormal	TL + MO3-ttc8	Fig. 6 from May-Simera et al., 2010
Kupffer's vesicle decreased functionality, abnormal	TL + MO3-ttc8	Fig. 6 from May-Simera et al., 2010
Kupffer's vesicle motile cilium decreased length, abnormal	TL + MO3-ttc8	Fig. 4 from May-Simera et al., 2010
Kupffer's vesicle motile cilium movement quality, abnormal	TL + MO3-ttc8	Fig. 6 from May-Simera et al., 2010
Kupffer's vesicle development disrupted, abnormal	TL + MO3-ttc8	Fig. 4 from May-Simera et al., 2010
left/right pattern formation disrupted, abnormal	TL + MO3-ttc8	Fig. 3 from May-Simera et al., 2010
mandibular arch skeleton aplastic, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
neural crest cell migration disrupted, abnormal	ba2Tg + MO3-ttc8	Fig. 3 from Tobin et al., 2008
neurocranium decreased size, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
pharyngeal arch 3-7 aplastic, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
pigmentation disrupted, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
post-vent region increased curvature, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
somite morphology, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
somite border amorphous, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
trabecula communis aplastic, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
trabecula cranii decreased length, abnormal	ba2Tg + MO3-ttc8	Fig. 3 from Tobin et al., 2008
trabecula cranii fused with trabecula cranii, abnormal	WT + MO3-ttc8	Fig. 2 from Tobin et al., 2008
ventricular system morphology, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010
whole organism anterior-posterior axis decreased length, abnormal	TL + MO3-ttc8	Fig. 1 from May-Simera et al., 2010

Phenotype of all Fish created by or utilizing MO3-ttc8

Phenotype	Fish	Conditions	Figures
Kupffer's vesicle motile cilium decreased length, abnormal	TL + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
left/right pattern formation disrupted, abnormal	TL + MO3-ttc8	standard conditions	Fig. 3 from May-Simera et al., 2010
Kupffer's vesicle decreased fluid flow, abnormal	TL + MO3-ttc8	standard conditions	Fig. 6 from May-Simera et al., 2010
somite morphology, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
Kupffer's vesicle decreased functionality, abnormal	TL + MO3-ttc8	standard conditions	Fig. 6 from May-Simera et al., 2010
cilium assembly disrupted, abnormal	TL + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
pigmentation disrupted, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
eye decreased distance eye, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
eye decreased size, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
whole organism anterior-posterior axis decreased length, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
post-vent region increased curvature, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
somite border amorphous, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
Kupffer's vesicle development disrupted, abnormal	TL + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
Kupffer's vesicle motile cilium movement quality, abnormal	TL + MO3-ttc8	standard conditions	Fig. 6 from May-Simera et al., 2010
convergent extension disrupted, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
ventricular system morphology, abnormal	TL + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
eye fused with eye, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
neurocranium decreased size, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
trabecula communis aplastic, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
mandibular arch skeleton aplastic, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
kidney edematous, abnormal	WT + MO3-ttc8	standard conditions	Fig. 1 from Tobin et al., 2008
trabecula cranii fused with trabecula cranii, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
pharyngeal arch 3-7 aplastic, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
cranial cartilage aplastic, abnormal	WT + MO3-ttc8	standard conditions	Fig. 2 from Tobin et al., 2008
trabecula cranii decreased length, abnormal	ba2Tg + MO3-ttc8	standard conditions	Fig. 3 from Tobin et al., 2008
neural crest cell migration disrupted, abnormal	ba2Tg + MO3-ttc8	standard conditions	Fig. 3 from Tobin et al., 2008
heart looping disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 3 from May-Simera et al., 2010
inner ear altered number of otolith, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
cilium assembly disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
otolith development disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
otolith decreased size, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
whole organism anterior-posterior axis decreased length, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
actin filament organization disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
eye decreased distance eye, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
neural rod increased width, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
presumptive rhombomere 1 decreased distance somite 1, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
somite condensed, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
Kupffer's vesicle motile cilium decreased amount, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
somite filamentous actin disorganized, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
otolith amount, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
Kupffer's vesicle decreased fluid flow, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 6 from May-Simera et al., 2010
left/right pattern formation disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 3 from May-Simera et al., 2010
embryonic heart tube left/right pattern formation decreased process quality, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 3 from May-Simera et al., 2010
Kupffer's vesicle motile cilium movement quality, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 6 from May-Simera et al., 2010
Kupffer's vesicle decreased functionality, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 6 from May-Simera et al., 2010
Kupffer's vesicle development disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
Kupffer's vesicle motile cilium decreased length, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 4 from May-Simera et al., 2010
convergent extension disrupted, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 1 from May-Simera et al., 2010
heart tube bilateral symmetry, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 3 from May-Simera et al., 2010
somite morphology, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 2 from May-Simera et al., 2010
Kupffer's vesicle nucleus increased distance Kupffer's vesicle apical plasma membrane, abnormal	vangl2^m209/m209 + MO3-ttc8	standard conditions	Fig. 5 from May-Simera et al., 2010

Citations