Morpholino

MO3-ttc8

ID
ZDB-MRPHLNO-080918-2
Name
MO3-ttc8
Previous Names
None
Target
Sequence
5' - TCTCACCGGAGAAACACCACACACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ttc8
No data available
Phenotype
Phenotype resulting from MO3-ttc8
Phenotype Fish Figures
cilium assembly disrupted, abnormal TL + MO3-ttc8 Fig. 4 with image from May-Simera et al., 2010
convergent extension disrupted, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
cranial cartilage aplastic, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
eye decreased distance eye, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
eye decreased size, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
eye fused with eye, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
kidney edematous, abnormal WT + MO3-ttc8 Fig. 1 with image from Tobin et al., 2008
Kupffer's vesicle decreased fluid flow, abnormal TL + MO3-ttc8 Fig. 6 with image from May-Simera et al., 2010
Kupffer's vesicle decreased functionality, abnormal TL + MO3-ttc8 Fig. 6 with image from May-Simera et al., 2010
Kupffer's vesicle motile cilium decreased length, abnormal TL + MO3-ttc8 Fig. 4 with image from May-Simera et al., 2010
Kupffer's vesicle motile cilium movement quality, abnormal TL + MO3-ttc8 Fig. 6 with image from May-Simera et al., 2010
Kupffer's vesicle development disrupted, abnormal TL + MO3-ttc8 Fig. 4 with image from May-Simera et al., 2010
left/right pattern formation disrupted, abnormal TL + MO3-ttc8 Fig. 3 with image from May-Simera et al., 2010
mandibular arch skeleton aplastic, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
neural crest cell migration disrupted, abnormal ba2Tg + MO3-ttc8 Fig. 3 with image from Tobin et al., 2008
neurocranium decreased size, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
pigmentation disrupted, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
post-vent region increased curvature, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
somite morphology, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
somite border amorphous, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
trabecula communis aplastic, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
trabecula cranii decreased length, abnormal ba2Tg + MO3-ttc8 Fig. 3 with image from Tobin et al., 2008
trabecula cranii fused with trabecula cranii, abnormal WT + MO3-ttc8 Fig. 2 with image from Tobin et al., 2008
ventricular system morphology, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
whole organism anterior-posterior axis decreased length, abnormal TL + MO3-ttc8 Fig. 1 with image from May-Simera et al., 2010
Phenotype of all Fish created by or utilizing MO3-ttc8
Phenotype Fish Conditions Figures
Kupffer's vesicle motile cilium decreased length, abnormal TL + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
left/right pattern formation disrupted, abnormal TL + MO3-ttc8 standard conditions Fig. 3 with image from May-Simera et al., 2010
Kupffer's vesicle decreased fluid flow, abnormal TL + MO3-ttc8 standard conditions Fig. 6 with image from May-Simera et al., 2010
somite morphology, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
Kupffer's vesicle decreased functionality, abnormal TL + MO3-ttc8 standard conditions Fig. 6 with image from May-Simera et al., 2010
cilium assembly disrupted, abnormal TL + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
pigmentation disrupted, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
eye decreased distance eye, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
eye decreased size, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
whole organism anterior-posterior axis decreased length, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
post-vent region increased curvature, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
somite border amorphous, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
Kupffer's vesicle development disrupted, abnormal TL + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
Kupffer's vesicle motile cilium movement quality, abnormal TL + MO3-ttc8 standard conditions Fig. 6 with image from May-Simera et al., 2010
convergent extension disrupted, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
ventricular system morphology, abnormal TL + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
eye fused with eye, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
neurocranium decreased size, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
trabecula communis aplastic, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
mandibular arch skeleton aplastic, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
kidney edematous, abnormal WT + MO3-ttc8 standard conditions Fig. 1 with image from Tobin et al., 2008
trabecula cranii fused with trabecula cranii, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
cranial cartilage aplastic, abnormal WT + MO3-ttc8 standard conditions Fig. 2 with image from Tobin et al., 2008
trabecula cranii decreased length, abnormal ba2Tg + MO3-ttc8 standard conditions Fig. 3 with image from Tobin et al., 2008
neural crest cell migration disrupted, abnormal ba2Tg + MO3-ttc8 standard conditions Fig. 3 with image from Tobin et al., 2008
heart looping disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 3 with image from May-Simera et al., 2010
inner ear altered number of otolith, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
cilium assembly disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
otolith development disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
otolith decreased size, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
whole organism anterior-posterior axis decreased length, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
actin filament organization disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
eye decreased distance eye, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
neural rod increased width, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
presumptive rhombomere 1 decreased distance somite 1, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
somite condensed, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
Kupffer's vesicle motile cilium decreased amount, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
somite filamentous actin disorganized, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
otolith amount, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
Kupffer's vesicle decreased fluid flow, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 6 with image from May-Simera et al., 2010
left/right pattern formation disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 3 with image from May-Simera et al., 2010
embryonic heart tube left/right pattern formation decreased process quality, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 3 with image from May-Simera et al., 2010
Kupffer's vesicle motile cilium movement quality, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 6 with image from May-Simera et al., 2010
Kupffer's vesicle decreased functionality, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 6 with image from May-Simera et al., 2010
Kupffer's vesicle development disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
Kupffer's vesicle motile cilium decreased length, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 4 with image from May-Simera et al., 2010
convergent extension disrupted, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 1 with image from May-Simera et al., 2010
heart tube bilateral symmetry, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 3 with image from May-Simera et al., 2010
somite morphology, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 2 with image from May-Simera et al., 2010
Kupffer's vesicle nucleus increased distance Kupffer's vesicle apical plasma membrane, abnormal vangl2m209/m209 + MO3-ttc8 standard conditions Fig. 5 with image from May-Simera et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.