Morpholino

MO1-prrc1

ID
ZDB-MRPHLNO-080915-1
Name
MO1-prrc1
Previous Names
  • mys-ATG-MO (1)
Target
Sequence
5' - CTTCCATCATCTTCACTCTGTTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prrc1
Expressed Gene Anatomy Figures
en1a Fig. 5,  Fig. 6 from Kotani et al., 2010
foxa Fig. 5,  Fig. 6 from Kotani et al., 2010
pax2a Fig. 5,  Fig. 6 from Kotani et al., 2010
pax6a Fig. 5 from Kotani et al., 2010
prkar1aa Fig. 4 from Kotani et al., 2010
prrc1 Fig. 4 from Kotani et al., 2010
ptch2 Fig. 5,  Fig. 6 from Kotani et al., 2010
twist2 Fig. 5 from Kotani et al., 2010
Phenotype
Phenotype resulting from MO1-prrc1
Phenotype Fish Figures
cell lamellipodium decreased amount, abnormal WT + MO1-prrc1 Fig. 9 with image from Kotani et al., 2008
epithelial structure maintenance disrupted, abnormal WT + MO1-prrc1 Fig. 5 with image,  Fig. 6 with image from Kotani et al., 2008
formation of anatomical boundary delayed, abnormal WT + MO1-prrc1 Fig. 4 with image from Kotani et al., 2008
protein kinase activity decreased occurrence, abnormal TL + MO1-prrc1 Fig. 4 from Kotani et al., 2010
somite morphology, abnormal WT + MO1-prrc1 Fig. 4 with image from Kotani et al., 2008
somite actin cytoskeleton disorganized, abnormal WT + MO1-prrc1 Fig. 6 with image from Kotani et al., 2008
somite epithelial cell morphology, abnormal WT + MO1-prrc1 Fig. 5 with image from Kotani et al., 2008
somite laminin complex decreased amount, abnormal WT + MO1-prrc1 Fig. 6 with image from Kotani et al., 2008
trunk musculature disorganized, abnormal nksagm011dGt + MO1-prrc1 Fig. 7 with image from Kotani et al., 2008
whole organism curved ventral, abnormal WT + MO1-prrc1 Fig. 4 with image from Kotani et al., 2008
Phenotype of all Fish created by or utilizing MO1-prrc1
Phenotype Fish Conditions Figures
protein kinase activity decreased occurrence, abnormal TL + MO1-prrc1 standard conditions Fig. 4 from Kotani et al., 2010
somite actin cytoskeleton disorganized, abnormal WT + MO1-prrc1 standard conditions Fig. 6 with image from Kotani et al., 2008
whole organism curved ventral, abnormal WT + MO1-prrc1 standard conditions Fig. 4 with image from Kotani et al., 2008
somite laminin complex decreased amount, abnormal WT + MO1-prrc1 standard conditions Fig. 6 with image from Kotani et al., 2008
formation of anatomical boundary delayed, abnormal WT + MO1-prrc1 standard conditions Fig. 4 with image from Kotani et al., 2008
cell lamellipodium decreased amount, abnormal WT + MO1-prrc1 standard conditions Fig. 9 with image from Kotani et al., 2008
epithelial structure maintenance disrupted, abnormal WT + MO1-prrc1 standard conditions Fig. 5 with image,  Fig. 6 with image from Kotani et al., 2008
somite morphology, abnormal WT + MO1-prrc1 standard conditions Fig. 4 with image from Kotani et al., 2008
somite epithelial cell morphology, abnormal WT + MO1-prrc1 standard conditions Fig. 5 with image from Kotani et al., 2008
trunk musculature disorganized, abnormal nksagm011dGt + MO1-prrc1 standard conditions Fig. 7 with image from Kotani et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.