Morpholino

MO3-pax3a

ID
ZDB-MRPHLNO-080911-2
Name
MO3-pax3a
Previous Names
  • MO3-pax3 (1)
Target
Sequence
5' - CTAATGCGGTCATATCTCCTCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-pax3a
Expressed Gene Anatomy Figures
aox5 Fig. 3 with image,  text only from Minchin et al., 2008
csf1ra Fig. 3 with image from Minchin et al., 2008
dbh Fig. S3 with image from Minchin et al., 2008
dct Fig. 7 with image from Minchin et al., 2008
dlx2a Fig. 5 with image from Minchin et al., 2013
Fig. S3 with image from Minchin et al., 2008
elavl3 Fig. 8 with image,  Fig. S2 with image,  Fig. S3 with image from Minchin et al., 2008
foxd3 Fig. 8 with image,  Fig. S2 with image from Minchin et al., 2008
gch2 Fig. 3 with image from Minchin et al., 2008
lbx2 Fig. 5 with image from Minchin et al., 2013
mitfa Fig. 3 with image,  text only from Minchin et al., 2008
myf5 Fig. 6 with image from Minchin et al., 2013
myog Fig. 6 with image from Minchin et al., 2013
pax7a Fig. 3 with image from Minchin et al., 2008
sox10 Fig. 8 with image,  Fig. S2 with image from Minchin et al., 2008
Phenotype
Phenotype resulting from MO3-pax3a
Phenotype Fish Figures
cranial neural crest morphology, abnormal WT + MO3-pax3a Fig. 8 with image from Minchin et al., 2008
cranial neural crest cell decreased amount, abnormal WT + MO3-pax3a Fig. S2 with image from Minchin et al., 2008
dorsal root ganglion sensory neuron mislocalised dorsally, abnormal sb3Tg + MO3-pax3a Fig. S2 with image from Minchin et al., 2008
enteric nervous system neuron neural crest derived absent, abnormal WT + MO3-pax3a Fig. S3 with image from Minchin et al., 2008
enteric nervous system development disrupted, abnormal WT + MO3-pax3a Fig. 8 with image from Minchin et al., 2008
head pterinosome decreased amount, abnormal WT + MO3-pax3a Fig. 2 with image from Minchin et al., 2008
head xanthophore decreased amount, abnormal WT + MO3-pax3a Fig. 3 with image from Minchin et al., 2008
melanoblast decreased amount, abnormal WT + MO3-pax3a Fig. 7 with image from Minchin et al., 2008
melanocyte differentiation delayed, abnormal WT + MO3-pax3a Fig. 7 with image,  text only from Minchin et al., 2008
melanophore stripe melanocyte increased amount, abnormal WT + MO3-pax3a Fig. 7 with image from Minchin et al., 2008
neural crest cell delaminated, abnormal WT + MO3-pax3a Fig. 8 with image from Minchin et al., 2008
neural crest cell migration disrupted, abnormal WT + MO3-pax3a Fig. 8 with image from Minchin et al., 2008
neural plate morphology, abnormal WT + MO3-pax3a Fig. 8 with image from Minchin et al., 2008
presumptive enteric nervous system neuron neural crest derived decreased amount, abnormal WT + MO3-pax3a Fig. 8 with image from Minchin et al., 2008
trunk melanocyte decreased size, abnormal WT + MO3-pax3a Fig. 7 with image from Minchin et al., 2008
trunk melanocyte increased amount, abnormal WT + MO3-pax3a Fig. 7 with image from Minchin et al., 2008
trunk melanocyte mislocalised, abnormal WT + MO3-pax3a Fig. 7 with image from Minchin et al., 2008
trunk pterinosome absent, abnormal WT + MO3-pax3a Fig. 2 with image from Minchin et al., 2008
trunk xanthophore absent, abnormal WT + MO3-pax3a Fig. 3 with image from Minchin et al., 2008
trunk xanthophore colorless, abnormal WT + MO3-pax3a Fig. 7 with image,  Fig. S2 with image from Minchin et al., 2008
trunk neural crest cell decreased amount, abnormal WT + MO3-pax3a Fig. 8 with image,  Fig. S2 with image from Minchin et al., 2008
xanthophore decreased amount, abnormal WT + MO3-pax3a Fig. 2 with image from Minchin et al., 2008
xanthophore differentiation disrupted, abnormal WT + MO3-pax3a Fig. 2 with image,  Fig. 3 with image from Minchin et al., 2008
Phenotype of all Fish created by or utilizing MO3-pax3a
Phenotype Fish Conditions Figures
melanophore stripe melanocyte increased amount, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
head xanthophore decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. 3 with image from Minchin et al., 2008
head pterinosome decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. 2 with image from Minchin et al., 2008
enteric nervous system neuron neural crest derived absent, abnormal WT + MO3-pax3a standard conditions Fig. S3 with image from Minchin et al., 2008
trunk neural crest cell decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image,  Fig. S2 with image from Minchin et al., 2008
neural crest cell migration disrupted, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image from Minchin et al., 2008
cranial neural crest cell decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. S2 with image from Minchin et al., 2008
melanoblast decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
trunk melanocyte decreased size, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
neural plate morphology, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image from Minchin et al., 2008
xanthophore differentiation disrupted, abnormal WT + MO3-pax3a standard conditions Fig. 2 with image,  Fig. 3 with image from Minchin et al., 2008
trunk pterinosome absent, abnormal WT + MO3-pax3a standard conditions Fig. 2 with image from Minchin et al., 2008
trunk xanthophore absent, abnormal WT + MO3-pax3a standard conditions Fig. 3 with image from Minchin et al., 2008
trunk xanthophore colorless, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
neural crest cell delaminated, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image from Minchin et al., 2008
enteric nervous system development disrupted, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image from Minchin et al., 2008
melanocyte differentiation delayed, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image,  text only from Minchin et al., 2008
presumptive enteric nervous system neuron neural crest derived decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image from Minchin et al., 2008
trunk melanocyte increased amount, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
cranial neural crest morphology, abnormal WT + MO3-pax3a standard conditions Fig. 8 with image from Minchin et al., 2008
trunk melanocyte mislocalised, abnormal WT + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2008
xanthophore decreased amount, abnormal WT + MO3-pax3a standard conditions Fig. 2 with image from Minchin et al., 2008
dorsal root ganglion sensory neuron mislocalised dorsally, abnormal sb3Tg + MO3-pax3a standard conditions Fig. S2 with image from Minchin et al., 2008
trunk xanthophore colorless, abnormal sb3Tg + MO3-pax3a standard conditions Fig. S2 with image from Minchin et al., 2008
esophagus lacks parts or has fewer parts of type skeletal muscle cell, abnormal WT + MO1-pax3b + MO3-pax3a standard conditions Fig. 6 with image from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal WT + MO1-pax3b + MO3-pax3a standard conditions Fig. 5 with image,  Fig. 6 with image from Minchin et al., 2013
esophagus skeletal muscle cell poorly differentiated, abnormal WT + MO1-pax3b + MO3-pax3a standard conditions Fig. 5 with image from Minchin et al., 2013
mastication decreased process quality, abnormal WT + MO1-pax3b + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal WT + MO2-pax3b + MO3-pax3a standard conditions Fig. 6 with image from Minchin et al., 2013
esophagus skeletal muscle cell poorly differentiated, abnormal WT + MO2-pax3b + MO3-pax3a standard conditions Fig. 6 with image from Minchin et al., 2013
sternohyoid decreased size, abnormal zf13Tg + MO1-pax3b + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2013
pectoral fin musculature decreased size, abnormal zf13Tg + MO1-pax3b + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal zf13Tg + MO1-pax3b + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2013
pectoral fin musculature disorganized, abnormal zf13Tg + MO1-pax3b + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2013
sternohyoid disorganized, abnormal zf13Tg + MO1-pax3b + MO3-pax3a standard conditions Fig. 7 with image from Minchin et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.