Morpholino

MO1-churc1

ID

ZDB-MRPHLNO-080721-3

Name

MO1-churc1

Previous Names

None

Target

Sequence

5' - GCTTCTGGACACAACCGGTACACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-churc1

Expressed Gene	Anatomy	Figures
chrd	presumptive mesoderm	Fig. 2 from Londin et al., 2007
gata2a	ectoderm	Fig. 3 from Londin et al., 2007
hoxb1b	ectoderm	Fig. 3 from Londin et al., 2007
mixl1	endoderm	Fig. 3 from Londin et al., 2007
noto	mesoderm presumptive mesoderm	Fig. 2 , Fig. 3 from Londin et al., 2007
otx2b	anterior neural plate ectoderm neural plate	Fig. 3 from Londin et al., 2007
six3a	neural plate	Fig. 3 from Londin et al., 2007
sox3	ectoderm	Fig. 3 from Londin et al., 2007
sox17	endoderm	Fig. 3 from Londin et al., 2007
tbx16	mesoderm presumptive mesoderm	Fig. 2 , Fig. 3 from Londin et al., 2007
tbx16l	mesoderm	Fig. 3 from Londin et al., 2007
tbxta	mesoderm presumptive mesoderm	Fig. 2 , Fig. 3 from Londin et al., 2007
zeb2b	presumptive mesoderm	Fig. 2 from Londin et al., 2007

Phenotype

Phenotype resulting from MO1-churc1

Phenotype	Fish	Figures
brain structure, abnormal	WT + MO1-churc1	Fig. 1 from Londin et al., 2007
notochord deformed, abnormal	WT + MO1-churc1	Fig. 1 from Londin et al., 2007
notochord increased width, abnormal	WT + MO1-churc1	Fig. 1 from Londin et al., 2007
somite deformed, abnormal	WT + MO1-churc1	Fig. 1 from Londin et al., 2007
somite increased size, abnormal	WT + MO1-churc1	Fig. 1 from Londin et al., 2007
somite anterior-posterior axis condensed, abnormal	WT + MO1-churc1	Fig. 1 from Kok et al., 2010
somite medial-lateral axis increased width, abnormal	WT + MO1-churc1	Fig. 1 from Kok et al., 2010
whole organism decreased length, abnormal	WT + MO1-churc1	Fig. 1 from Londin et al., 2007
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-churc1	Fig. 1 from Kok et al., 2010
whole organism medial-lateral axis increased width, abnormal	WT + MO1-churc1	Fig. 1 from Kok et al., 2010

Phenotype of all Fish created by or utilizing MO1-churc1

Phenotype	Fish	Conditions	Figures
notochord deformed, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Londin et al., 2007
whole organism decreased length, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Londin et al., 2007
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Kok et al., 2010
somite increased size, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Londin et al., 2007
brain structure, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Londin et al., 2007
notochord increased width, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Londin et al., 2007
somite anterior-posterior axis condensed, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Kok et al., 2010
somite deformed, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Londin et al., 2007
whole organism medial-lateral axis increased width, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Kok et al., 2010
somite medial-lateral axis increased width, abnormal	WT + MO1-churc1	standard conditions	Fig. 1 from Kok et al., 2010

Citations