header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080714-5
Morpholino Name: MO1-heg1
Target: heg1 (1)
Sequence:
5' - GTAATCGTACTTGCAGCAGGTGACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: designed against intron 11 donor site
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-heg1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-heg1
Expressed Gene Anatomy Figures
cdh5 Fig. S9 from Kleaveland et al., 2009
myb Fig. 3 from Wang et al., 2011
rag1 Fig. 3 from Wang et al., 2011
runx1 Fig. 3 from Wang et al., 2011
tcf21 Fig. 6 with image from Serluca, 2008
wt1a Fig. 6 with image from Serluca, 2008
PHENOTYPE
Phenotype resulting from MO1-heg1
Phenotype of all Fish created by or utilizing MO1-heg1
Genome Resources:
CITATIONS (6)