ZFIN ID: ZDB-MRPHLNO-080714-3
Morpholino Name: MO2-supt6h
Target: supt6h (1)
Sequence:
5' - CCTCGCTCTCGATGAAGTCAGACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-supt6h No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-supt6h
Expressed Gene Anatomy Figures
tcf21 Fig. 6 with image from Serluca, 2008
wt1a Fig. 6 with image from Serluca, 2008
PHENOTYPE
Phenotype resulting from MO2-supt6h
Phenotype Figures
heart decreased size, abnormal Fig. 6 with image from Serluca, 2008
pericardium edematous, abnormal Fig. 6 with image from Serluca, 2008
post-vent region decreased size, abnormal Fig. 6 with image from Serluca, 2008

Phenotype of all Fish created by or utilizing MO2-supt6h
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO2-supt6h standard conditions Fig. 6 with image from Serluca, 2008
post-vent region decreased size, abnormal WT + MO2-supt6h standard conditions Fig. 6 with image from Serluca, 2008
heart decreased size, abnormal WT + MO2-supt6h standard conditions Fig. 6 with image from Serluca, 2008
OTHER MO2-supt6h MORPHOLINO PAGESNo links to external sites
CITATIONS (2)