Morpholino

MO2-tjp3

ID
ZDB-MRPHLNO-080623-2
Name
MO2-tjp3
Previous Names
None
Target
Sequence
5' - ACCTCGCCACTTACTTTCGATAACG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tjp3
Expressed Gene Anatomy Figures
pax2b Fig. 7 with image from Kiener et al., 2008
tjp1a Fig. 6 with image from Kiener et al., 2008
tjp3 Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image from Kiener et al., 2008
Phenotype
Phenotype resulting from MO2-tjp3
Phenotype Fish Figures
blood circulation arrested, abnormal AB + MO2-tjp3 Fig. 2 with image,  Fig. 4 with image,  Fig. 10 with image from Kiener et al., 2008
blood island increased size, abnormal AB + MO2-tjp3 Fig. 2 with image from Kiener et al., 2008
caudal fin decreased size, abnormal AB + MO2-tjp3 Fig. 2 with image,  Fig. 4 with image,  Fig. 10 with image from Kiener et al., 2008
EVL lacks parts or has fewer parts of type EVL bicellular tight junction, abnormal AB + MO2-tjp3 Fig. 6 with image from Kiener et al., 2008
EVL bicellular tight junction decreased amount, abnormal AB + MO2-tjp3 Fig. 6 with image from Kiener et al., 2008
pericardium edematous, abnormal AB + MO2-tjp3 Fig. 2 with image,  Fig. 4 with image,  Fig. 10 with image from Kiener et al., 2008
post-vent region decreased length, abnormal AB + MO2-tjp3 Fig. 2 with image from Kiener et al., 2008
post-vent region increased curvature, abnormal AB + MO2-tjp3 Fig. 2 with image,  Fig. 10 with image from Kiener et al., 2008
post-vent region structure, abnormal AB + MO2-tjp3 Fig. 4 with image from Kiener et al., 2008
whole organism decreased length, abnormal AB + MO2-tjp3 Fig. 2 with image from Kiener et al., 2008
Phenotype of all Fish created by or utilizing MO2-tjp3
Phenotype Fish Conditions Figures
post-vent region structure, abnormal AB + MO2-tjp3 standard conditions Fig. 4 with image from Kiener et al., 2008
whole organism decreased length, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: sodium chloride Fig. 9 with image from Kiener et al., 2008
post-vent region increased curvature, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image,  Fig. 10 with image from Kiener et al., 2008
EVL increased permeability, abnormal AB + MO2-tjp3 chemical treatment: biotin Fig. 8 with image from Kiener et al., 2008
EVL lacks parts or has fewer parts of type EVL bicellular tight junction, abnormal AB + MO2-tjp3 standard conditions Fig. 6 with image from Kiener et al., 2008
blood circulation arrested, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 10 with image from Kiener et al., 2008
post-vent region decreased length, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: sodium chloride Fig. 9 with image from Kiener et al., 2008
EVL bicellular tight junction decreased amount, abnormal AB + MO2-tjp3 standard conditions Fig. 6 with image from Kiener et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO2-tjp3 chemical treatment: sucrose Fig. 10 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: salt Fig. 9 with image from Kiener et al., 2008
caudal fin decreased size, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 10 with image from Kiener et al., 2008
pericardium edematous, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 10 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: magnesium sulfate Fig. 9 with image from Kiener et al., 2008
pericardium edematous, abnormal AB + MO2-tjp3 chemical treatment: sucrose Fig. 10 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: calcium dichloride Fig. 9 with image from Kiener et al., 2008
whole organism decreased life span, abnormal AB + MO2-tjp3 chemical treatment: salt Fig. 9 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: calcium dichloride Fig. 9 with image from Kiener et al., 2008
blood island increased size, abnormal AB + MO2-tjp3 standard conditions Fig. 2 with image from Kiener et al., 2008
response to osmotic stress disrupted, abnormal AB + MO2-tjp3 chemical treatment: magnesium sulfate Fig. 9 with image from Kiener et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.