Morpholino

MO3-smad5

ID
ZDB-MRPHLNO-080610-1
Name
MO3-smad5
Previous Names
None
Target
Sequence
5' - ACATGGAGGTCATAGTGCTGGGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-smad5
Expressed Gene Anatomy Figures
hbbe3 Fig. 3 from McReynolds et al., 2007
tbx5a Fig. 4 with image from Erickson et al., 2010
Phenotype
Phenotype resulting from MO3-smad5
Phenotype Fish Figures
cloacal chamber cellular quality, abnormal pt510Tg + MO3-smad5 Fig. s3 with image from Laux et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO3-smad5 Fig. 4 with image from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO3-smad5 Fig. 4 with image from Erickson et al., 2010
epiphysis has fewer parts of type photoreceptor cell, abnormal y8Tg + MO3-smad5 Fig. 2 with image from Quillien et al., 2011
heart looping arrested, abnormal WT + MO3-smad5 Fig. 2 from McReynolds et al., 2007
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO3-smad5 Fig. 2,  Fig. 3 from McReynolds et al., 2007
otic placode decreased size, abnormal WT + MO3-smad5 Fig. 2 from McReynolds et al., 2007
post-vent region decreased length, abnormal WT + MO3-smad5 Fig. 2 from McReynolds et al., 2007
post-vent region increased curvature, abnormal WT + MO3-smad5 Fig. 2 from McReynolds et al., 2007
post-vent region kinked, abnormal WT + MO3-smad5 Fig. 2 from McReynolds et al., 2007
post-vent region truncated, abnormal WT + MO3-smad5 Fig. s3 with image from Laux et al., 2011
retina dorsal region cellular quality, abnormal pt510Tg + MO3-smad5 Fig. s3 with image from Laux et al., 2011
somite cellular quality, abnormal pt510Tg + MO3-smad5 Fig. s3 with image from Laux et al., 2011
whole organism wholly dorsalized, abnormal WT + MO3-smad5 Fig. s3 with image from Laux et al., 2011
Fig. 2 from McReynolds et al., 2007
Phenotype of all Fish created by or utilizing MO3-smad5
Phenotype Fish Conditions Figures
dorsal/ventral pattern formation disrupted, abnormal AB + MO3-smad5 standard conditions Fig. 4 with image from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO3-smad5 standard conditions Fig. 4 with image from Erickson et al., 2010
whole organism wholly dorsalized, abnormal WT + MO3-smad5 standard conditions Fig. s3 with image from Laux et al., 2011
Fig. 2 from McReynolds et al., 2007
heart looping arrested, abnormal WT + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
otic placode decreased size, abnormal WT + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
post-vent region increased curvature, abnormal WT + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
nucleate erythrocyte decreased amount, abnormal WT + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
post-vent region truncated, abnormal WT + MO3-smad5 standard conditions Fig. s3 with image from Laux et al., 2011
post-vent region decreased length, abnormal WT + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
post-vent region kinked, abnormal WT + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
somite cellular quality, abnormal pt510Tg + MO3-smad5 standard conditions Fig. s3 with image from Laux et al., 2011
cloacal chamber cellular quality, abnormal pt510Tg + MO3-smad5 standard conditions Fig. s3 with image from Laux et al., 2011
retina dorsal region cellular quality, abnormal pt510Tg + MO3-smad5 standard conditions Fig. s3 with image from Laux et al., 2011
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO3-smad5 standard conditions Fig. 3 from McReynolds et al., 2007
epiphysis has fewer parts of type photoreceptor cell, abnormal y8Tg + MO3-smad5 standard conditions Fig. 2 with image from Quillien et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-meis1b + MO3-smad5 standard conditions Fig. 4 with image from Erickson et al., 2010
embryonic retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-meis1b + MO3-smad5 standard conditions Fig. 4 with image from Erickson et al., 2010
axial blood vessel ephb4a expression decreased amount, abnormal WT + MO1-smad1 + MO3-smad5 control Fig. S8 with image from Neal et al., 2019
neuroectoderm degenerate, abnormal WT + MO1-smad1 + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
dorsal aorta efnb2a expression decreased amount, abnormal WT + MO1-smad1 + MO3-smad5 control Fig. S8 with image from Neal et al., 2019
post-vent region increased curvature, abnormal WT + MO1-smad1 + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
axial blood vessel dll4 expression decreased amount, abnormal WT + MO1-smad1 + MO3-smad5 control Fig. S8 with image from Neal et al., 2019
whole organism dead, abnormal WT + MO1-smad1 + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
posterior cardinal vein EGFP expression absent, abnormal lcr4Tg + MO1-smad1 + MO3-smad5 control Fig. 6 with image from Neal et al., 2019
intersegmental vessel EGFP expression absent, abnormal lcr4Tg + MO1-smad1 + MO3-smad5 control Fig. 6 with image from Neal et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.