Morpholino

MO2-dlx2a

ID
ZDB-MRPHLNO-080429-2
Name
MO2-dlx2a
Previous Names
None
Target
Sequence
5' - CTCCAGTCATGTTTTTCATACCGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dlx2a
No data available
Phenotype
Phenotype resulting from MO2-dlx2a
Phenotype of all Fish created by or utilizing MO2-dlx2a
Phenotype Fish Conditions Figures
ceratobranchial cartilage chondrocyte decreased amount, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
cranial neural crest apoptotic, abnormal WT + MO2-dlx2a standard conditions Fig. 3 with image from Sperber et al., 2008
ethmoid cartilage decreased size, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
palatoquadrate cartilage deformed, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
trabecula cranii decreased size, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
hyosymplectic cartilage deformed, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
Meckel's cartilage deformed, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage decreased size, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
head apoptotic, abnormal WT + MO2-dlx2a standard conditions Fig. 4 with image from Sperber et al., 2008
head decreased size, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
ceratohyal cartilage deformed, abnormal WT + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
palatoquadrate cartilage morphology, abnormal AB + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 1 with image from Talbot et al., 2010
hyosymplectic cartilage morphology, abnormal AB + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 1 with image from Talbot et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal AB + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 1 with image from Talbot et al., 2010
hypothalamus morphology, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. S2 with image from MacDonald et al., 2013
ceratobranchial cartilage chondrocyte decreased amount, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
trabecula cranii decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage chondrocyte decreased amount, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
head decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
head apoptotic, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 4 with image from Sperber et al., 2008
ceratohyal cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
hyosymplectic cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
ethmoid cartilage decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
interhyal cartilage aplastic, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
ceratobranchial cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage decreased size, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
pharyngeal arch cartilage deformed, abnormal WT + MO1-dlx1a + MO2-dlx2a standard conditions Fig. 2 with image from Sperber et al., 2008
Citations