Morpholino
MO2-myd88
- ID
- ZDB-MRPHLNO-080325-4
- Name
- MO2-myd88
- Previous Names
- None
- Target
- Sequence
-
5' - GTTAAACACTGACCCTGTGGATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice blocker (exon2-intron2)
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-myd88
No data available
Phenotype
Phenotype resulting from MO2-myd88
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-myd88
1 - 5 of 25 Show all
Citations
- Peña, O.A., Lubin, A., Hockings, C., Rowell, J., Jung, Y., Hoade, Y., Dace, P.E.I., Valdivia, L.E., Tuschl, K., Boiers, C., Virgilio, M., Richardson, S.E., Payne, E.M. (2021) TLR7 ligation augments hematopoiesis in Rps14 (uS11) deficiency via paradoxical suppression of inflammatory signalling. Blood advances. 5(20):4112-4124
- Cafora, M., Brix, A., Forti, F., Loberto, N., Aureli, M., Briani, F., Pistocchi, A. (2020) Phages as immunomodulators and their promising use as anti-inflammatory agents in a cftr loss-of-function zebrafish model. Journal of cystic fibrosis : official journal of the European Cystic Fibrosis Society. 20(6):1046-1052
- Cambier, C.J., Banik, S.M., Buonomo, J.A., Bertozzi, C.R. (2020) Spreading of a mycobacterial cell surface lipid into host epithelial membranes promotes infectivity. eLIFE. 9:
- Yang, L., Jiménez, J.A., Earley, A.M., Hamlin, V., Kwon, V., Dixon, C.T., Shiau, C.E. (2020) Drainage of inflammatory macromolecules from brain to periphery targets the liver for macrophage infiltration. eLIFE. 9:
- Rosowski, E.E., Raffa, N., Knox, B.P., Golenberg, N., Keller, N.P., Huttenlocher, A. (2018) Macrophages inhibit Aspergillus fumigatus germination and neutrophil-mediated fungal killing. PLoS pathogens. 14:e1007229
- Troll, J.V., Hamilton, M.K., Abel, M.L., Ganz, J., Bates, J.M., Stephens, W.Z., Melancon, E., van der Vaart, M., Meijer, A.H., Distel, M., Eisen, J.S., Guillemin, K. (2018) Microbiota promote secretory cell determination in the intestinal epithelium by modulating host Notch signaling. Development (Cambridge, England). 145(4)
- Cambier, C.J., O'Leary, S.M., O'Sullivan, M.P., Keane, J., Ramakrishnan, L. (2017) Phenolic Glycolipid Facilitates Mycobacterial Escape from Microbicidal Tissue-Resident Macrophages. Immunity. 47(3):552-565.e4
- Madigan, C.A., Cambier, C.J., Kelly-Scumpia, K.M., Scumpia, P.O., Cheng, T.Y., Zailaa, J., Bloom, B.R., Moody, D.B., Smale, S.T., Sagasti, A., Modlin, R.L., Ramakrishnan, L. (2017) A Macrophage Response to Mycobacterium leprae Phenolic Glycolipid Initiates Nerve Damage in Leprosy. Cell. 170:973-985.e10
- Mesureur, J., Feliciano, J.R., Wagner, N., Gomes, M.C., Zhang, L., Blanco-Gonzalez, M., van der Vaart, M., O'Callaghan, D., Meijer, A.H., Vergunst, A.C. (2017) Macrophages, but not neutrophils, are critical for proliferation of Burkholderia cenocepacia and ensuing host-damaging inflammation. PLoS pathogens. 13:e1006437
- Fehr, A.G., Ruetten, M., Seth-Smith, H.M., Nufer, L., Voegtlin, A., Lehner, A., Greub, G., Crosier, P.S., Neuhauss, S.C., Vaughan, L. (2016) A Zebrafish Model for Chlamydia Infection with the Obligate Intracellular Pathogen Waddlia chondrophila.. Frontiers in microbiology. 7:1829
1 - 10 of 17
Show