Morpholino

MO2-myd88

ID

ZDB-MRPHLNO-080325-4

Name

MO2-myd88

Previous Names

None

Target

myd88 (1)

Sequence

5' - GTTAAACACTGACCCTGTGGATCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice blocker (exon2-intron2)

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-myd88

No data available

Phenotype

Phenotype resulting from MO2-myd88

Phenotype	Fish	Figures
activation of innate immune response decreased process quality, abnormal	WT + MO2-myd88	Fig. 6 from van der Vaart et al., 2013
alkaline phosphatase activity decreased occurrence, abnormal	WT + MO2-myd88	Fig. 1 from Bates et al., 2007
intestinal bulb peptide hormone secreting cell decreased amount, abnormal	WT + MO2-myd88	Fig. 4 from Troll et al., 2018
posterior intestine goblet cell decreased amount, abnormal	WT + MO2-myd88	Fig. 3, Fig. 4 from Troll et al., 2018
whole organism myd88 expression decreased amount, abnormal	WT + MO2-myd88	Fig. 8 from Fehr et al., 2016

Phenotype of all Fish created by or utilizing MO2-myd88

Phenotype	Fish	Conditions	Figures
fourth ventricle monocyte decreased amount, abnormal	AB + MO2-myd88	bacterial treatment by injection: Pseudomonas aeruginosa	Fig. 1 from Cambier et al., 2017
fourth ventricle monocyte decreased amount, abnormal	AB + MO2-myd88	bacterial treatment by injection: Staphylococcus aureus	Fig. 1 from Cambier et al., 2017
fourth ventricle monocyte chemotaxis decreased occurrence, abnormal	AB + MO2-myd88	bacterial treatment by injection: Staphylococcus aureus	Fig. 1 from Cambier et al., 2017
fourth ventricle neutrophil decreased amount, abnormal	AB + MO2-myd88	bacterial treatment by injection: Staphylococcus aureus	Fig. 1 from Cambier et al., 2017
fourth ventricle neutrophil decreased amount, abnormal	AB + MO2-myd88	bacterial treatment by injection: Pseudomonas aeruginosa	Fig. 1 from Cambier et al., 2017
fourth ventricle monocyte chemotaxis decreased occurrence, abnormal	AB + MO2-myd88	bacterial treatment by injection: Pseudomonas aeruginosa	Fig. 1 from Cambier et al., 2017
whole organism neutrophil decreased amount, abnormal	WT + MO2-myd88	bacterial treatment by injection: Waddlia chondrophila WSU 86-1044	Fig. 8 from Fehr et al., 2016
posterior intestine goblet cell decreased amount, abnormal	WT + MO2-myd88	control	Fig. 3, Fig. 4 from Troll et al., 2018
activation of innate immune response decreased process quality, abnormal	WT + MO2-myd88	standard conditions	Fig. 6 from van der Vaart et al., 2013
alkaline phosphatase activity decreased occurrence, abnormal	WT + MO2-myd88	standard conditions	Fig. 1 from Bates et al., 2007
intestinal bulb peptide hormone secreting cell decreased amount, abnormal	WT + MO2-myd88	control	Fig. 4 from Troll et al., 2018
posterior intestine goblet cell decreased amount, abnormal	WT + MO2-myd88	germ free	Fig. 3 from Troll et al., 2018
whole organism decreased life span, exacerbated	WT + MO2-myd88	bacterial treatment by injection: Waddlia chondrophila WSU 86-1044	Fig. 8 from Fehr et al., 2016
whole organism myd88 expression decreased amount, abnormal	WT + MO2-myd88	control	Fig. 8 from Fehr et al., 2016
macrophage chemotaxis decreased occurrence, abnormal	w201Tg + MO2-myd88 (AB)	bacterial treatment by injection: Mycobacterium leprae	Fig. 1 from Madigan et al., 2017
macrophage chemotaxis decreased occurrence, abnormal	w201Tg + MO2-myd88 (AB)	bacterial treatment by injection: Mycobacterium marinum	Fig. 1 from Madigan et al., 2017
neutrophil decreased amount, abnormal	hkz04tTg; nz50Tg + MO2-myd88 + MO4-myd88	amputation: caudal fin	Fig. 2 from Yan et al., 2014
neutrophil chemotaxis decreased process quality, abnormal	hkz04tTg; nz50Tg + MO2-myd88 + MO4-myd88	amputation: caudal fin	Fig. 2, Fig. 4 from Yan et al., 2014
epithelial cell proliferation increased occurrence, abnormal	axin1^tm213/tm213 + MO2-myd88	standard conditions	Fig. 4 from Cheesman et al., 2011
intestinal bulb epithelium cellular quality, abnormal	axin1^tm213/tm213 + MO2-myd88	standard conditions	Fig. 4 from Cheesman et al., 2011
posterior intestine goblet cell increased amount, abnormal	dld^tr233/tr233 + MO2-myd88	control	Fig. 4 from Troll et al., 2018
intestinal bulb peptide hormone secreting cell amount, ameliorated	b1390Tg + MO2-myd88	control	Fig. 4 from Troll et al., 2018
cell autophagosome decreased amount, abnormal	zf155Tg + MO2-myd88	bacterial treatment: Mycobacterium marinum	Fig. 6 from van der Vaart et al., 2014
neutrophil decreased amount, abnormal	hkz04tTg; nz50Tg + MO2-myd88 + MO3-il1b + MO4-myd88	amputation: caudal fin	Fig. 2 from Yan et al., 2014
neutrophil chemotaxis decreased process quality, abnormal	hkz04tTg; nz50Tg + MO2-myd88 + MO3-il1b + MO4-myd88	amputation: caudal fin	Fig. 2 from Yan et al., 2014

Citations