Morpholino

MO2-tfap2c

ID
ZDB-MRPHLNO-080220-1
Name
MO2-tfap2c
Previous Names
  • tfap2c e3i3
Target
Sequence
5' - TCTGACATCAACTCACCTGAACATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino designed against the exon 3 splice donor site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfap2c
Expressed Gene Anatomy Figures
crestin Fig. 5 with image from Van Otterloo et al., 2012
dlx2a Fig. 5 with image from Li et al., 2007
eya1 Fig. 4 with image from Li et al., 2007
foxd3 Fig. 4 with image,  Fig. 6 with image from Li et al., 2007
isl1a Fig. 6 with image from Li et al., 2007
prdm1a Fig. 6 with image from Li et al., 2007
sox10 Fig. 5 with image from Li et al., 2007
tlx2 Fig. 6 with image from Li et al., 2007
Phenotype
Phenotype resulting from MO2-tfap2c
No data available
Phenotype of all Fish created by or utilizing MO2-tfap2c
Phenotype Fish Conditions Figures
retina malformed, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
lens aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
neuromast hair cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
whole organism morphology, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Van Otterloo et al., 2012
neural crest cell development disrupted, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 5 with image from Van Otterloo et al., 2012
enteric nervous system neuron absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
whole organism lacks all parts of type melanocyte, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Van Otterloo et al., 2012
head edematous, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
Rohon-Beard neuron distributed, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 6 with image from Li et al., 2007
whole organism curved ventral, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
post-vent region decreased length, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
cranial ganglion perineuronal satellite cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
cranial ganglion absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
median fin fold aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
Rohon-Beard neuron decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 6 with image from Li et al., 2007
olfactory placode aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
pectoral fin aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 3 with image from Li et al., 2007
otic vesicle decreased size, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
sympathetic nervous system neuron absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
melanocyte absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image,  Fig. 3 with image from Li et al., 2007
extension aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
otolith organ decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
dorsal root ganglion absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
hair cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
lateral line system myelinating Schwann cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
pharyngeal arch cartilage aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 3 with image from Li et al., 2007
anterior lateral line aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory field aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
post-vent region decreased length, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
extension aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
adenohypophyseal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
trigeminal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
ectodermal placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
melanocyte absent, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
olfactory pit aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode formation decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic vesicle hypoplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image,  Fig. 5 with image from Bhat et al., 2013
epibranchial ganglion aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
neural crest cell development disrupted, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Van Otterloo et al., 2012
melanocyte decreased amount, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
whole organism curved ventral, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
lens morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
olfactory pit morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.