ZFIN ID: ZDB-MRPHLNO-080215-1
Morpholino Name: MO3-aldh1a2
Target: aldh1a2 (1)
Sequence:
5' - CAACTTCACTGGAGGTCATCGCGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-aldh1a2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-aldh1a2
Expressed Gene Anatomy Figures
aqp3a Fig. 3 with image from Wingert et al., 2007
cdh17 Fig. 3 with image from Wingert et al., 2007
fabp10a Fig. 2 with image from Garnaas et al., 2012
gata3 Fig. 3 with image from Wingert et al., 2007
prox1a Fig. 2 with image from Garnaas et al., 2012
slc12a1 Fig. 3 with image from Wingert et al., 2007
slc12a3 Fig. 3 with image from Wingert et al., 2007
slc13a1 Fig. 3 with image from Wingert et al., 2007
slc20a1a Fig. 3 with image from Wingert et al., 2007
stc1l Fig. 3 with image from Wingert et al., 2007
wt1b Fig. 3 with image from Wingert et al., 2007
PHENOTYPE
Phenotype resulting from MO3-aldh1a2
Phenotype of all Fish created by or utilizing MO3-aldh1a2
Genome Resources:
CITATIONS (2)