ZFIN ID: ZDB-MRPHLNO-080214-1
Morpholino Name: MO1-fstl1b
Target: fstl1b (1)
Previous Name: MOa-fstl2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAACACGGGTAAACACCGAAACATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fstl1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fstl1b No data available
PHENOTYPE
Phenotype resulting from MO1-fstl1b
No data available

Phenotype of all Fish created by or utilizing MO1-fstl1b
Phenotype Fish Conditions Figures
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
whole organism cytolysis increased occurrence, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 2 with image from Kapp et al., 2013
Fig. 8 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1(TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly dorsalized, ameliorated ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1(TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism cytolysis increased occurrence, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1(TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal ints6p18ahub + MO1-chrd + MO1-fstl1b + MO1-nog1(AB/TU) standard conditions Fig. 2 with image from Kapp et al., 2013
OTHER MO1-fstl1b MORPHOLINO PAGESNo links to external sites
CITATIONS (3)