ZFIN ID: ZDB-MRPHLNO-080212-2
Morpholino Name: MO2-nog1
Target: nog1 (1)
Previous Name: MOb-nog1

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGATTAAACGCGGGATTTATCCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-nog1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-nog1 No data available
PHENOTYPE
Phenotype resulting from MO2-nog1
Phenotype Figures
cerebellum decreased size, abnormal Fig. 2 with image from Dal-Pra et al., 2006
extension decreased thickness, abnormal Fig. 2 with image from Dal-Pra et al., 2006
midbrain hindbrain boundary decreased thickness, abnormal Fig. 2 with image from Dal-Pra et al., 2006
telencephalon protruding, abnormal Fig. 2 with image from Dal-Pra et al., 2006

Phenotype of all Fish created by or utilizing MO2-nog1
Phenotype Fish Conditions Figures
midbrain hindbrain boundary decreased thickness, abnormal WT + MO2-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
extension decreased thickness, abnormal WT + MO2-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
telencephalon protruding, abnormal WT + MO2-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
cerebellum decreased size, abnormal WT + MO2-nog1 standard conditions Fig. 2 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-nog1 standard conditions text only from Dal-Pra et al., 2006
OTHER MO2-nog1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)