Morpholino

MO1-polr3k

ID

ZDB-MRPHLNO-080124-3

Name

MO1-polr3k

Previous Names

None

Target

polr3k (1)

Sequence

5' - CAGGAGCATTTTCAAACAGTCATAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets start site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-polr3k

Expressed Gene	Anatomy	Figures
gata1a	hematopoietic system posterior region whole organism	Fig. 5 from Wei et al., 2016
myb	hematopoietic multipotent progenitor cell hematopoietic system posterior region whole organism	Fig. 5 from Wei et al., 2016
rag1	(not) thymus	Fig. 5 from Wei et al., 2016
spi1b	hematopoietic system posterior region whole organism	Fig. 5 from Wei et al., 2016

Phenotype

Phenotype resulting from MO1-polr3k

Phenotype	Fish	Figures
cranium morphology, abnormal	WT + MO1-polr3k	Fig. 6 from Yee et al., 2007
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
hematopoietic system posterior region myb expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
hematopoietic system posterior region gata1a expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
hematopoietic system posterior region spi1b expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
intestine decreased size, abnormal	WT + MO1-polr3k	Fig. 6 from Yee et al., 2007
pharyngeal arch decreased size, abnormal	WT + MO1-polr3k	Fig. 6 from Yee et al., 2007
thymus rag1 expression absent, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
thymus T cell absent, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
whole organism gata1a expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
whole organism spi1b expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016
whole organism myb expression decreased amount, abnormal	AB + MO1-polr3k	Fig. 5 from Wei et al., 2016

Phenotype of all Fish created by or utilizing MO1-polr3k

Phenotype	Fish	Conditions	Figures
thymus T cell absent, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
whole organism gata1a expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
hematopoietic system posterior region myb expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
thymus rag1 expression absent, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
hematopoietic system posterior region gata1a expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
hematopoietic system posterior region spi1b expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
whole organism myb expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
whole organism spi1b expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	AB + MO1-polr3k	standard conditions	Fig. 5 from Wei et al., 2016
pharyngeal arch decreased size, abnormal	WT + MO1-polr3k	standard conditions	Fig. 6 from Yee et al., 2007
cranium morphology, abnormal	WT + MO1-polr3k	standard conditions	Fig. 6 from Yee et al., 2007
intestine decreased size, abnormal	WT + MO1-polr3k	standard conditions	Fig. 6 from Yee et al., 2007

Citations