Morpholino

MO1-ctr9

ID

ZDB-MRPHLNO-071219-5

Name

MO1-ctr9

Previous Names

None

Target

ctr9 (1)

Sequence

5' - GATTTCAATGGATCCCCGAGACATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ctr9

No data available

Phenotype

Phenotype resulting from MO1-ctr9

Phenotype	Fish	Figures
cardiac cell fate specification process quality, abnormal	WT + MO1-ctr9	Fig. 5 from Langenbacher et al., 2011
cardiac muscle cell decreased amount, abnormal	WT + MO1-ctr9	Fig. 3 from Langenbacher et al., 2011
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal	WT + MO1-ctr9	Fig. 3 from Langenbacher et al., 2011
embryonic heart tube morphogenesis disrupted, abnormal	WT + MO1-ctr9	Fig. 3 from Langenbacher et al., 2011
heart development disrupted, abnormal	WT + MO1-ctr9	Fig. 4 from Akanuma et al., 2007
myocardial precursor decreased amount, abnormal	WT + MO1-ctr9	Fig. 3 from Langenbacher et al., 2011
neural crest crestin expression decreased amount, abnormal	AB + MO1-ctr9	Fig. 1 from Santoriello et al., 2020
neural crest cell decreased amount, abnormal	WT + MO1-ctr9	Fig. S5 from Akanuma et al., 2007
neural crest cell development disrupted, abnormal	WT + MO1-ctr9	Fig. S5 from Akanuma et al., 2007
otic vesicle decreased size, abnormal	WT + MO1-ctr9	Fig. 4 from Akanuma et al., 2007
pericardium edematous, abnormal	WT + MO1-ctr9	Fig. s1 from Langenbacher et al., 2011
pigment cell absent, abnormal	WT + MO1-ctr9	Fig. s1 from Langenbacher et al., 2011
pigmentation arrested, abnormal	WT + MO1-ctr9	Fig. s1 from Langenbacher et al., 2011
post-vent region decreased length, abnormal	WT + MO1-ctr9	Fig. 4 from Akanuma et al., 2007
post-vent region somite border disorganized, abnormal	WT + MO1-ctr9	Fig. 4 from Akanuma et al., 2007
whole organism curved ventral, abnormal	WT + MO1-ctr9	Fig. s1 from Langenbacher et al., 2011

Phenotype of all Fish created by or utilizing MO1-ctr9

Phenotype	Fish	Conditions	Figures
neural crest crestin expression decreased amount, abnormal	AB + MO1-ctr9	control	Fig. 1 from Santoriello et al., 2020
neural crest crestin expression amount, ameliorated	AB + MO1-ctr9	chemical treatment by environment: progesterone	Fig. 1 from Santoriello et al., 2020
cardiac cell fate specification process quality, abnormal	WT + MO1-ctr9	standard conditions	Fig. 5 from Langenbacher et al., 2011
heart development disrupted, abnormal	WT + MO1-ctr9	standard conditions	Fig. 4 from Akanuma et al., 2007
otic vesicle decreased size, abnormal	WT + MO1-ctr9	standard conditions	Fig. 4 from Akanuma et al., 2007
cardiac muscle progenitor cell migration to the midline involved in heart field formation delayed, abnormal	WT + MO1-ctr9	standard conditions	Fig. 3 from Langenbacher et al., 2011
pigmentation arrested, abnormal	WT + MO1-ctr9	standard conditions	Fig. s1 from Langenbacher et al., 2011
embryonic heart tube morphogenesis disrupted, abnormal	WT + MO1-ctr9	standard conditions	Fig. 3 from Langenbacher et al., 2011
neural crest cell decreased amount, abnormal	WT + MO1-ctr9	standard conditions	Fig. S5 from Akanuma et al., 2007
myocardial precursor decreased amount, abnormal	WT + MO1-ctr9	standard conditions	Fig. 3 from Langenbacher et al., 2011
cardiac muscle cell decreased amount, abnormal	WT + MO1-ctr9	standard conditions	Fig. 3 from Langenbacher et al., 2011
post-vent region somite border disorganized, abnormal	WT + MO1-ctr9	standard conditions	Fig. 4 from Akanuma et al., 2007
post-vent region decreased length, abnormal	WT + MO1-ctr9	standard conditions	Fig. 4 from Akanuma et al., 2007
pigment cell absent, abnormal	WT + MO1-ctr9	standard conditions	Fig. s1 from Langenbacher et al., 2011
whole organism curved ventral, abnormal	WT + MO1-ctr9	standard conditions	Fig. s1 from Langenbacher et al., 2011
neural crest cell development disrupted, abnormal	WT + MO1-ctr9	standard conditions	Fig. S5 from Akanuma et al., 2007
pericardium edematous, abnormal	WT + MO1-ctr9	standard conditions	Fig. s1 from Langenbacher et al., 2011
trunk somite border disorganized, abnormal	rtf1^kt641/kt641 + MO1-ctr9	standard conditions	Fig. 4 from Akanuma et al., 2007
neural crest cell development disrupted, abnormal	rtf1^kt641/kt641 + MO1-ctr9	standard conditions	Fig. S5 from Akanuma et al., 2007
neural crest cell decreased amount, abnormal	rtf1^kt641/kt641 + MO1-ctr9	standard conditions	Fig. S5 from Akanuma et al., 2007
erythrocyte differentiation decreased occurrence, abnormal	trim33^tg234/tg234 + MO1-ctr9	standard conditions	Fig. 3 from Bai et al., 2010

Citations