Morpholino
MO1-hsp90aa1.2
- ID
- ZDB-MRPHLNO-071128-3
- Name
- MO1-hsp90aa1.2
- Previous Names
-
- hsp90a-Mo (1)
- MO1-hsp90a.2
- Target
-
- hsp90aa1.2 (1)
- Sequence
-
5' - TCGAGTGGTTTATTCTGAGAGTTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Morpholino sequences for hsp90a.1 and hsp90a.2 genes are reversed in Etard et al.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsp90aa1.2
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| hsp90aa1.1 |
Fig. S8 
from Hawkins et al., 2008 |
|
| hspa8l |
Fig. S8
from Hawkins et al., 2008 |
|
| unc45b |
Fig. S8
from Hawkins et al., 2008 |
1 - 3 of 3
Phenotype
Phenotype resulting from MO1-hsp90aa1.2
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism curved, abnormal | WT + MO1-hsp90aa1.2 |
Fig. 6
from Etard et al., 2007 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-hsp90aa1.2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism curved, abnormal | WT + MO1-hsp90aa1.2 | standard conditions |
Fig. 6
from Etard et al., 2007 |
1 - 1 of 1
Citations
- Etard, C., Armant, O., Roostalu, U., Gourain, V., Ferg, M., Strähle, U. (2015) Loss of function of myosin chaperones triggers Hsf1-mediated transcriptional response in skeletal muscle cells. Genome biology. 16:267
- Hawkins, T.A., Haramis, A.P., Etard, C., Prodromou, C., Vaughan, C.K., Ashworth, R., Ray, S., Behra, M., Holder, N., Talbot, W.S., Pearl, L.H., Strähle, U., and Wilson, S.W. (2008) The ATPase-dependent chaperoning activity of Hsp90a regulates thick filament formation and integration during skeletal muscle myofibrillogenesis. Development (Cambridge, England). 135(6):1147-1156
- Etard, C., Behra, M., Fischer, N., Hutcheson, D., Geisler, R., and Strähle, U. (2007) The UCS factor Steif/Unc-45b interacts with the heat shock protein Hsp90a during myofibrillogenesis. Developmental Biology. 308(1):133-143
1 - 3 of 3
Show